ID: 1134847872

View in Genome Browser
Species Human (GRCh38)
Location 16:17456097-17456119
Sequence CTGTGTGCACAGAGTGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134847872_1134847876 -8 Left 1134847872 16:17456097-17456119 CCAGCTTCACTCTGTGCACACAG No data
Right 1134847876 16:17456112-17456134 GCACACAGAGGATGGGAATCAGG No data
1134847872_1134847878 -2 Left 1134847872 16:17456097-17456119 CCAGCTTCACTCTGTGCACACAG No data
Right 1134847878 16:17456118-17456140 AGAGGATGGGAATCAGGGTGAGG 0: 1
1: 0
2: 7
3: 50
4: 595
1134847872_1134847879 -1 Left 1134847872 16:17456097-17456119 CCAGCTTCACTCTGTGCACACAG No data
Right 1134847879 16:17456119-17456141 GAGGATGGGAATCAGGGTGAGGG 0: 1
1: 0
2: 3
3: 48
4: 521
1134847872_1134847877 -7 Left 1134847872 16:17456097-17456119 CCAGCTTCACTCTGTGCACACAG No data
Right 1134847877 16:17456113-17456135 CACACAGAGGATGGGAATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134847872 Original CRISPR CTGTGTGCACAGAGTGAAGC TGG (reversed) Intronic
No off target data available for this crispr