ID: 1134849308

View in Genome Browser
Species Human (GRCh38)
Location 16:17468088-17468110
Sequence AGTCTGGTATAGCTGGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 135}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134849308_1134849322 25 Left 1134849308 16:17468088-17468110 CCAAGCTCCAGCTATACCAGACT 0: 1
1: 0
2: 0
3: 17
4: 135
Right 1134849322 16:17468136-17468158 TCTCCTGGAGCTCCATGGAAGGG No data
1134849308_1134849321 24 Left 1134849308 16:17468088-17468110 CCAAGCTCCAGCTATACCAGACT 0: 1
1: 0
2: 0
3: 17
4: 135
Right 1134849321 16:17468135-17468157 GTCTCCTGGAGCTCCATGGAAGG No data
1134849308_1134849313 2 Left 1134849308 16:17468088-17468110 CCAAGCTCCAGCTATACCAGACT 0: 1
1: 0
2: 0
3: 17
4: 135
Right 1134849313 16:17468113-17468135 GGGAACAGCCTGCCCCCTTCTGG No data
1134849308_1134849320 20 Left 1134849308 16:17468088-17468110 CCAAGCTCCAGCTATACCAGACT 0: 1
1: 0
2: 0
3: 17
4: 135
Right 1134849320 16:17468131-17468153 TCTGGTCTCCTGGAGCTCCATGG No data
1134849308_1134849324 29 Left 1134849308 16:17468088-17468110 CCAAGCTCCAGCTATACCAGACT 0: 1
1: 0
2: 0
3: 17
4: 135
Right 1134849324 16:17468140-17468162 CTGGAGCTCCATGGAAGGGCAGG No data
1134849308_1134849315 10 Left 1134849308 16:17468088-17468110 CCAAGCTCCAGCTATACCAGACT 0: 1
1: 0
2: 0
3: 17
4: 135
Right 1134849315 16:17468121-17468143 CCTGCCCCCTTCTGGTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134849308 Original CRISPR AGTCTGGTATAGCTGGAGCT TGG (reversed) Intronic
902159502 1:14518693-14518715 AGTGTGGTAGTGCTGGAGCCTGG - Intergenic
905339133 1:37266370-37266392 AGTCTGCTGAGGCTGGAGCTGGG - Intergenic
905569587 1:38992634-38992656 AGTCTGGGACAGCTTTAGCTGGG - Intronic
906511736 1:46413932-46413954 AGACTGGCATGGCTGGAGCCTGG - Intergenic
907735691 1:57109474-57109496 AGTCTGGTATGGATGGAACTTGG + Intronic
908658409 1:66412632-66412654 AGTCTGCTTTATCTGAAGCTAGG + Intergenic
908723396 1:67149381-67149403 AGTGTGGAATAACTGCAGCTAGG - Intronic
915079020 1:153338581-153338603 AGTGTGGTAGAGCTGATGCTGGG - Intronic
918258178 1:182769257-182769279 AGTCTGGGAAATATGGAGCTGGG - Intergenic
922209588 1:223477339-223477361 AGTCTGGTTTAGTTGGGCCTTGG - Intergenic
924536567 1:244940473-244940495 AGTCAGGCATGGCGGGAGCTGGG + Intergenic
1064774790 10:18764442-18764464 AGTGTGGTATGGGTGCAGCTGGG + Intergenic
1068016553 10:51524092-51524114 AGTCTTCTATAGCAGGAGCAAGG - Intronic
1068149685 10:53116210-53116232 AGGCTGGTATGGCTGGGGCTGGG - Intergenic
1070261626 10:74861572-74861594 AATGTGGTAGAGCTGGAGCCAGG + Intronic
1073644971 10:105292509-105292531 ACTGTGGTGTAGCTGGAGATGGG + Intergenic
1073924742 10:108502526-108502548 ATTCCAGTTTAGCTGGAGCTGGG + Intergenic
1074782365 10:116811220-116811242 ACACTGGTGTGGCTGGAGCTTGG + Intergenic
1080052462 11:27871139-27871161 AGGCTGGTGCAGCTGGAGCCGGG + Intergenic
1083342781 11:61969005-61969027 AGTCTGGGATAGGAGGAGGTCGG + Intergenic
1085552892 11:77391465-77391487 CTTCTGGTTTAGATGGAGCTGGG - Intronic
1086374039 11:86182584-86182606 AGTCAGCTATAGCTGGAGACTGG + Intergenic
1089705403 11:120274198-120274220 GGTCAGGTAGTGCTGGAGCTAGG - Intronic
1089949152 11:122509493-122509515 AGTCTGCTGTTGCTGGAGTTAGG + Intergenic
1092679513 12:10962454-10962476 AGTCTGATATAGCTGCATCAAGG + Intronic
1093722023 12:22454770-22454792 AGTCTAGTAGAACTGGAGCACGG - Intronic
1093947475 12:25126181-25126203 GGTCAGGTATAGCTGGAGTGAGG + Intronic
1096568877 12:52507170-52507192 AGCCTGGTCTAGCTGGAGAAAGG - Intergenic
1104187871 12:126449707-126449729 TGTTTGTTATGGCTGGAGCTGGG - Intergenic
1106049582 13:26177816-26177838 AGTAGGGCATAGCTAGAGCTGGG - Intronic
1106451949 13:29890142-29890164 AGGATGGTAGAGCTGGAGCTTGG - Intergenic
1106967388 13:35087928-35087950 AGTTTTCTATAGCTGGAGTTTGG + Intronic
1107569236 13:41638965-41638987 AGGCTGGTACAGCTGCAGATGGG + Intronic
1107579337 13:41765342-41765364 AGTCTTGTAAATCTGGAGGTGGG - Intronic
1109518493 13:63476622-63476644 AGGCTGGCATAGCTGGAGCCTGG - Intergenic
1112109753 13:96283063-96283085 AGTCTGGGATAGCAGATGCTTGG - Intronic
1113041261 13:106106128-106106150 AGTTTGGTAATGCTTGAGCTGGG + Intergenic
1114630438 14:24156140-24156162 AGTGTTGTATGGCTGGAGCCTGG + Intronic
1114675061 14:24434785-24434807 AGTGTGGTATAGGGGGAACTGGG - Intronic
1115431151 14:33320196-33320218 TGTCTAGTGTAGCTGGAGCATGG + Intronic
1117362891 14:54995413-54995435 AGTCTGCCATAGCAGAAGCTTGG + Intronic
1117375548 14:55115412-55115434 AGGCTGATTTACCTGGAGCTGGG + Intergenic
1117963082 14:61181387-61181409 AGTCTGGTCGAGCTGCACCTTGG - Intergenic
1118454178 14:65929961-65929983 AGTGGGGTATAGTTGGAGTTGGG - Intergenic
1124362652 15:29049433-29049455 AGTCTGGAACTTCTGGAGCTAGG + Intronic
1130031763 15:80321197-80321219 AGTCTTCTATAGCTGAATCTTGG + Intergenic
1130203489 15:81854471-81854493 ACTCTGGTTTACCTGGGGCTGGG - Intergenic
1131115335 15:89791866-89791888 GCTCTGGTGTAGCTGGACCTGGG - Intronic
1133439441 16:5808092-5808114 ATTCTGATATACCAGGAGCTAGG - Intergenic
1133447731 16:5876572-5876594 AGGCTGGTTTAGCTGTAGCAGGG - Intergenic
1134637997 16:15807613-15807635 AGTCTGGGAAGGCTGGAGCTGGG + Intronic
1134849308 16:17468088-17468110 AGTCTGGTATAGCTGGAGCTTGG - Intronic
1136246800 16:28980942-28980964 AGTCAGGTAAAGCTGGATCCAGG + Intronic
1138301082 16:55930321-55930343 AGGCTGGTGTGGCTGGAGCAGGG - Intronic
1140412939 16:74752433-74752455 ACTCTGGCATTGCTGGAGCATGG - Intronic
1141978273 16:87532833-87532855 AGTCTTTTATATCTGGTGCTTGG - Intergenic
1142042049 16:87900451-87900473 AGGCTGGTCCAGATGGAGCTGGG - Intronic
1143486416 17:7257550-7257572 CCTCTGGTGTAGCTGGAGGTGGG + Intronic
1144073138 17:11692581-11692603 AGTGTTGTATACCTGGGGCTTGG + Intronic
1148146615 17:45369585-45369607 AATCTGTCATTGCTGGAGCTGGG + Intergenic
1149479970 17:56995436-56995458 AATCTGGTATTGCTGCAGTTAGG - Intronic
1151228529 17:72664880-72664902 TGGCTGGTGTAGCTGGAGCTAGG - Intronic
1152559089 17:81068921-81068943 AGCCTGGAGCAGCTGGAGCTCGG - Intronic
1153227752 18:2910870-2910892 AGGCTGATTAAGCTGGAGCTTGG + Intronic
1153250067 18:3112516-3112538 AGTCTTGTATCCCTGGTGCTAGG - Intronic
1153409995 18:4782653-4782675 GGTAGGGCATAGCTGGAGCTCGG - Intergenic
1155433134 18:25782900-25782922 AGCATGGTTTAGCTGAAGCTAGG + Intergenic
1156478070 18:37419028-37419050 CCTCTGGTATGGCTGGAGCTGGG + Intronic
1156506604 18:37599796-37599818 AGGCTGTGATGGCTGGAGCTGGG - Intergenic
1156742374 18:40347569-40347591 ATTCAGAGATAGCTGGAGCTGGG - Intergenic
1156825804 18:41429119-41429141 AGTTTTGTACAGCTGAAGCTGGG + Intergenic
1157305717 18:46515973-46515995 GGTGTGGTAAAGCTGGAGGTAGG - Intronic
1157347431 18:46852463-46852485 AGTCTGGCATCCCTGGAGCCAGG - Intronic
1158411754 18:57211754-57211776 AGTTTAGGATGGCTGGAGCTTGG + Intergenic
1162004128 19:7766439-7766461 AGTCTGGAAGAGATGGAGCCAGG + Intronic
1167254883 19:48421479-48421501 AGGCTGGCATGGCAGGAGCTGGG - Intronic
1167469708 19:49668846-49668868 AGTCTGGAGTAGCTGGGCCTGGG - Exonic
926772929 2:16394153-16394175 ATTCTGGCAGAACTGGAGCTGGG - Intergenic
927025775 2:19067633-19067655 AGTCTGCTATCAGTGGAGCTGGG + Intergenic
927475679 2:23412586-23412608 AGCCTGGGACCGCTGGAGCTGGG + Intronic
927633225 2:24792690-24792712 TGCCTGGTCTAGCTGAAGCTAGG + Intronic
932779537 2:74551363-74551385 AGTCTGGTGGGGCAGGAGCTAGG - Intronic
935329619 2:101967264-101967286 AGTCAGGCTTAGCTGGATCTGGG + Intergenic
937986308 2:127639705-127639727 GGTGTGGGATGGCTGGAGCTGGG - Intronic
938906436 2:135840997-135841019 AGTCTTGTATATCTGGACATTGG - Intronic
938976501 2:136483289-136483311 AGTTTGGTAGAGCTGGAGTCAGG + Intergenic
939283490 2:140097225-140097247 AATCTGGTATGGCTAGAGCCAGG + Intergenic
940162617 2:150729672-150729694 TGTCTGCTATATTTGGAGCTAGG - Intergenic
941932160 2:170953053-170953075 AGACTGGTAAAGGAGGAGCTAGG + Intronic
942101643 2:172589683-172589705 AGTTAGGTAAAGCTGGAGCCTGG + Intronic
942919512 2:181354480-181354502 AGTCTGGTATGGTTGGCACTAGG - Intergenic
943765926 2:191662584-191662606 AGTTTGATGTAGCTGGAGCAGGG + Intergenic
946388707 2:219402264-219402286 ATTCTGATATAGATGCAGCTGGG + Intergenic
946442787 2:219710961-219710983 AGTCAAGTATAGCTGGGGATGGG + Intergenic
947981431 2:234413329-234413351 ATTCTTGTAAAGCTAGAGCTTGG - Intergenic
948431338 2:237921075-237921097 AGCCTGTTATAGCAGCAGCTTGG - Intergenic
1172692875 20:36802757-36802779 CTTCAGGTATAGCTGGATCTAGG - Intronic
1173270332 20:41528290-41528312 TGGCTGGTATAGCTGGAGGAGGG - Intronic
1174762102 20:53216342-53216364 AGTCAGGTAAAGCTGGAGTGAGG + Intronic
1183318294 22:37148857-37148879 AGGGTGGTAAAGCAGGAGCTCGG + Intronic
1183405996 22:37630973-37630995 AGGCTGGTGGCGCTGGAGCTGGG - Exonic
951975792 3:28506774-28506796 ATTCTGGTATAGTAGGAGCTTGG - Intronic
952228849 3:31408237-31408259 AGTGTGGTGGAGGTGGAGCTGGG + Intergenic
953386658 3:42510128-42510150 AGCCTGGTGTAGCTGCAGCAAGG - Intronic
955360260 3:58268020-58268042 AGTGTGGTATAGCACGATCTTGG - Intronic
958723656 3:97877026-97877048 AATCTGGCATTGCTGGGGCTGGG - Exonic
958988452 3:100811782-100811804 AGTCTGTTTTGGCTGGTGCTAGG + Intronic
965741638 3:171881431-171881453 AGGCTGGTGTAGCTGGAGCGTGG + Intronic
969119766 4:4899575-4899597 TGTCTGGCTTGGCTGGAGCTCGG - Intergenic
969240614 4:5894588-5894610 TGTCTGGTATTCCTGGAGCTTGG - Intergenic
971075553 4:23144857-23144879 AGGCTGATATGGCTGGAGATAGG + Intergenic
974335327 4:60536360-60536382 AGACCAGTATAGCTGGAGCATGG - Intergenic
975018061 4:69449183-69449205 AGTGTGGTATCCCTGTAGCTAGG + Intergenic
976194626 4:82520968-82520990 AGACTGGAATGGCTGGAGCCAGG - Intronic
976886137 4:89986754-89986776 AGTCATGCATAGCTGGGGCTGGG - Intergenic
982806712 4:159774281-159774303 AGTCTGGTATTGGTGGGCCTGGG - Intergenic
983330347 4:166319362-166319384 AGGCTGGTATGGCTGGAAGTGGG - Intergenic
983891473 4:173034445-173034467 CATATGGTATAGCTGGAGCAAGG - Intronic
987566611 5:19596445-19596467 ATTCTGGTTTAGTTGGACCTTGG - Intronic
992386763 5:76292133-76292155 AGGCTGGTATGGCTGGGGCTGGG - Intronic
998223970 5:140311999-140312021 TGTCTGGCATTGCTGGAGCAGGG + Intergenic
999248923 5:150170078-150170100 AGTCTGGAATGGCTAGAGCTTGG - Intronic
1001082549 5:168677834-168677856 ACTCTGGGCTTGCTGGAGCTGGG + Intronic
1006460647 6:34155673-34155695 CTTCTGGGATAGCTGGAGCCTGG - Intergenic
1007910427 6:45508045-45508067 AGTCTGGAAATGGTGGAGCTTGG + Intronic
1008540550 6:52543048-52543070 ATGCTGGTATAGCTTGAACTTGG + Intronic
1011207577 6:84916469-84916491 AGTCTGGTCTAGCTTAATCTAGG + Intergenic
1011725400 6:90205598-90205620 AGTTTGGTATGGCTGGAGCAGGG - Intronic
1017314549 6:153015432-153015454 AGGCTGGTATTGCTGAAGGTTGG - Intronic
1018258471 6:161945624-161945646 AGTTTGGTTTAGCTGCAACTTGG - Intronic
1026006051 7:66601198-66601220 ATCCTGGTAGAGCAGGAGCTGGG - Intergenic
1027579843 7:79978527-79978549 AGTCAGGTTTAGCTGGAGTATGG + Intergenic
1028409643 7:90514837-90514859 AGGCTGGAATTGCTTGAGCTAGG + Intronic
1029184905 7:98731515-98731537 TGTCTGGCATAGGTGGAGCCTGG - Intergenic
1031232809 7:119131415-119131437 AGTCAGGTATAGCTGGAATCTGG - Intergenic
1032086492 7:128886638-128886660 TGTCAGGTATAGCAGGAGGTGGG - Exonic
1036206463 8:6809086-6809108 GGTCTGGGAGAGCTGGAGCTGGG + Exonic
1037269963 8:17115818-17115840 AGTCTGGTTTGGGTGGAGCAGGG - Intronic
1039300921 8:36207694-36207716 AGTAGGGTACAGCTGGAGCTGGG - Intergenic
1043399488 8:79869715-79869737 AGACTGGTATAGCTGGAGACTGG - Intergenic
1045557831 8:103231882-103231904 AGTCTGCATTAGCTGGAGCTGGG + Intergenic
1045879581 8:107021851-107021873 AGTTTTGTATTGCTGCAGCTTGG - Intergenic
1048222119 8:132551711-132551733 GGTCTGGGATAGCTGGAGAGTGG + Intergenic
1048816607 8:138340128-138340150 AGTCTGGAATAACTGCAGCGAGG + Intronic
1049093649 8:140535175-140535197 GGTGTGGTGTGGCTGGAGCTTGG - Intronic
1051228830 9:14932060-14932082 CCTCTGGAATAGCTGGAACTGGG + Intergenic
1059415415 9:114159299-114159321 ATTTTGGTATAGCTGTAGCCAGG + Intronic
1060395875 9:123316137-123316159 ATTCAGGTATGGCTGGATCTAGG + Intergenic
1193679960 X:84506333-84506355 AGTCTGGTGGAGCTGAATCTAGG + Intergenic
1194880257 X:99242138-99242160 AGCCGGGTAGAGCTGGACCTTGG - Intergenic
1196701410 X:118673315-118673337 AGACTGATGTAGCTGGAGCATGG + Intronic
1198324205 X:135551390-135551412 TGCCTTGAATAGCTGGAGCTGGG - Intronic
1201317455 Y:12662029-12662051 ACACTGGGATAGCTGCAGCTAGG - Intergenic