ID: 1134850767

View in Genome Browser
Species Human (GRCh38)
Location 16:17476875-17476897
Sequence GATTTCAGCAGAAGCACAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134850767_1134850772 21 Left 1134850767 16:17476875-17476897 CCAGCTGTGCTTCTGCTGAAATC No data
Right 1134850772 16:17476919-17476941 TCTACCCAATGCATCAGCAGAGG No data
1134850767_1134850769 -9 Left 1134850767 16:17476875-17476897 CCAGCTGTGCTTCTGCTGAAATC No data
Right 1134850769 16:17476889-17476911 GCTGAAATCCGCAGGCTTCCAGG No data
1134850767_1134850773 22 Left 1134850767 16:17476875-17476897 CCAGCTGTGCTTCTGCTGAAATC No data
Right 1134850773 16:17476920-17476942 CTACCCAATGCATCAGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134850767 Original CRISPR GATTTCAGCAGAAGCACAGC TGG (reversed) Intergenic
No off target data available for this crispr