ID: 1134855178

View in Genome Browser
Species Human (GRCh38)
Location 16:17512597-17512619
Sequence ATTGAGAAGATAAATGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134855168_1134855178 17 Left 1134855168 16:17512557-17512579 CCACTCCTCCTCCTCCAATTAAA No data
Right 1134855178 16:17512597-17512619 ATTGAGAAGATAAATGGGGAGGG No data
1134855169_1134855178 12 Left 1134855169 16:17512562-17512584 CCTCCTCCTCCAATTAAAGTATA No data
Right 1134855178 16:17512597-17512619 ATTGAGAAGATAAATGGGGAGGG No data
1134855172_1134855178 3 Left 1134855172 16:17512571-17512593 CCAATTAAAGTATACAAAGTAAG No data
Right 1134855178 16:17512597-17512619 ATTGAGAAGATAAATGGGGAGGG No data
1134855170_1134855178 9 Left 1134855170 16:17512565-17512587 CCTCCTCCAATTAAAGTATACAA No data
Right 1134855178 16:17512597-17512619 ATTGAGAAGATAAATGGGGAGGG No data
1134855171_1134855178 6 Left 1134855171 16:17512568-17512590 CCTCCAATTAAAGTATACAAAGT No data
Right 1134855178 16:17512597-17512619 ATTGAGAAGATAAATGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134855178 Original CRISPR ATTGAGAAGATAAATGGGGA GGG Intergenic
No off target data available for this crispr