ID: 1134855992

View in Genome Browser
Species Human (GRCh38)
Location 16:17519643-17519665
Sequence CTGCAAAAATGAAAAGAAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134855988_1134855992 27 Left 1134855988 16:17519593-17519615 CCCCAGACATGGATTTTCTATAA No data
Right 1134855992 16:17519643-17519665 CTGCAAAAATGAAAAGAAGACGG No data
1134855991_1134855992 1 Left 1134855991 16:17519619-17519641 CCTTCATTGTGAAAGTTTGTTGC No data
Right 1134855992 16:17519643-17519665 CTGCAAAAATGAAAAGAAGACGG No data
1134855989_1134855992 26 Left 1134855989 16:17519594-17519616 CCCAGACATGGATTTTCTATAAA No data
Right 1134855992 16:17519643-17519665 CTGCAAAAATGAAAAGAAGACGG No data
1134855990_1134855992 25 Left 1134855990 16:17519595-17519617 CCAGACATGGATTTTCTATAAAA No data
Right 1134855992 16:17519643-17519665 CTGCAAAAATGAAAAGAAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134855992 Original CRISPR CTGCAAAAATGAAAAGAAGA CGG Intergenic
No off target data available for this crispr