ID: 1134857995

View in Genome Browser
Species Human (GRCh38)
Location 16:17536784-17536806
Sequence CTGAATGAGAAGAGGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134857989_1134857995 -10 Left 1134857989 16:17536771-17536793 CCCAGATTCCTGCCTGAATGAGA No data
Right 1134857995 16:17536784-17536806 CTGAATGAGAAGAGGGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134857995 Original CRISPR CTGAATGAGAAGAGGGAGCC AGG Intergenic
No off target data available for this crispr