ID: 1134863338

View in Genome Browser
Species Human (GRCh38)
Location 16:17581192-17581214
Sequence CCATTTCCACAGAAAAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134863338_1134863341 4 Left 1134863338 16:17581192-17581214 CCTCTTTTTTTCTGTGGAAATGG No data
Right 1134863341 16:17581219-17581241 GCTAGTCCTCAAATCCACATGGG No data
1134863338_1134863340 3 Left 1134863338 16:17581192-17581214 CCTCTTTTTTTCTGTGGAAATGG No data
Right 1134863340 16:17581218-17581240 AGCTAGTCCTCAAATCCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134863338 Original CRISPR CCATTTCCACAGAAAAAAAG AGG (reversed) Intergenic
No off target data available for this crispr