ID: 1134868701

View in Genome Browser
Species Human (GRCh38)
Location 16:17632131-17632153
Sequence AGACAAAAGCTACAGGTGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134868696_1134868701 15 Left 1134868696 16:17632093-17632115 CCTTCTCATGGTTCCTTAAGTCA No data
Right 1134868701 16:17632131-17632153 AGACAAAAGCTACAGGTGGGCGG No data
1134868695_1134868701 16 Left 1134868695 16:17632092-17632114 CCCTTCTCATGGTTCCTTAAGTC No data
Right 1134868701 16:17632131-17632153 AGACAAAAGCTACAGGTGGGCGG No data
1134868694_1134868701 19 Left 1134868694 16:17632089-17632111 CCTCCCTTCTCATGGTTCCTTAA No data
Right 1134868701 16:17632131-17632153 AGACAAAAGCTACAGGTGGGCGG No data
1134868693_1134868701 22 Left 1134868693 16:17632086-17632108 CCACCTCCCTTCTCATGGTTCCT No data
Right 1134868701 16:17632131-17632153 AGACAAAAGCTACAGGTGGGCGG No data
1134868697_1134868701 2 Left 1134868697 16:17632106-17632128 CCTTAAGTCACAATCGAAAGAAA No data
Right 1134868701 16:17632131-17632153 AGACAAAAGCTACAGGTGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134868701 Original CRISPR AGACAAAAGCTACAGGTGGG CGG Intergenic
No off target data available for this crispr