ID: 1134871667

View in Genome Browser
Species Human (GRCh38)
Location 16:17657508-17657530
Sequence ACGTGGATGAAGAGAGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134871665_1134871667 5 Left 1134871665 16:17657480-17657502 CCTTTTCGCTGTGAAATATAAAA No data
Right 1134871667 16:17657508-17657530 ACGTGGATGAAGAGAGAAGCTGG No data
1134871664_1134871667 30 Left 1134871664 16:17657455-17657477 CCAGATTTGCATTTTTTTCAGAT No data
Right 1134871667 16:17657508-17657530 ACGTGGATGAAGAGAGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134871667 Original CRISPR ACGTGGATGAAGAGAGAAGC TGG Intergenic
No off target data available for this crispr