ID: 1134879207

View in Genome Browser
Species Human (GRCh38)
Location 16:17729649-17729671
Sequence CTTGGAGCCTCTTGCCATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134879207_1134879214 -4 Left 1134879207 16:17729649-17729671 CCAGAATGGCAAGAGGCTCCAAG No data
Right 1134879214 16:17729668-17729690 CAAGGTGGCCCAGGGAAGCAGGG No data
1134879207_1134879218 10 Left 1134879207 16:17729649-17729671 CCAGAATGGCAAGAGGCTCCAAG No data
Right 1134879218 16:17729682-17729704 GAAGCAGGGAAGGTGTCTGAAGG No data
1134879207_1134879215 0 Left 1134879207 16:17729649-17729671 CCAGAATGGCAAGAGGCTCCAAG No data
Right 1134879215 16:17729672-17729694 GTGGCCCAGGGAAGCAGGGAAGG No data
1134879207_1134879213 -5 Left 1134879207 16:17729649-17729671 CCAGAATGGCAAGAGGCTCCAAG No data
Right 1134879213 16:17729667-17729689 CCAAGGTGGCCCAGGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134879207 Original CRISPR CTTGGAGCCTCTTGCCATTC TGG (reversed) Intergenic
No off target data available for this crispr