ID: 1134882046

View in Genome Browser
Species Human (GRCh38)
Location 16:17753499-17753521
Sequence TGGGACTCCCTCCGAAAATC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134882040_1134882046 12 Left 1134882040 16:17753464-17753486 CCCTGTGGGGACAGAGAGACAGG No data
Right 1134882046 16:17753499-17753521 TGGGACTCCCTCCGAAAATCCGG No data
1134882039_1134882046 24 Left 1134882039 16:17753452-17753474 CCAAAAATAAGTCCCTGTGGGGA No data
Right 1134882046 16:17753499-17753521 TGGGACTCCCTCCGAAAATCCGG No data
1134882042_1134882046 11 Left 1134882042 16:17753465-17753487 CCTGTGGGGACAGAGAGACAGGC No data
Right 1134882046 16:17753499-17753521 TGGGACTCCCTCCGAAAATCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134882046 Original CRISPR TGGGACTCCCTCCGAAAATC CGG Intergenic
No off target data available for this crispr