ID: 1134882442

View in Genome Browser
Species Human (GRCh38)
Location 16:17757474-17757496
Sequence TCCCAAAGGCTGGCCAGGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134882442_1134882447 -8 Left 1134882442 16:17757474-17757496 CCTCGCCTGGCCAGCCTTTGGGA No data
Right 1134882447 16:17757489-17757511 CTTTGGGATTTGATCCCTGGTGG No data
1134882442_1134882448 -7 Left 1134882442 16:17757474-17757496 CCTCGCCTGGCCAGCCTTTGGGA No data
Right 1134882448 16:17757490-17757512 TTTGGGATTTGATCCCTGGTGGG No data
1134882442_1134882449 -2 Left 1134882442 16:17757474-17757496 CCTCGCCTGGCCAGCCTTTGGGA No data
Right 1134882449 16:17757495-17757517 GATTTGATCCCTGGTGGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134882442 Original CRISPR TCCCAAAGGCTGGCCAGGCG AGG (reversed) Intergenic
No off target data available for this crispr