ID: 1134887714

View in Genome Browser
Species Human (GRCh38)
Location 16:17808639-17808661
Sequence TTATCAGTTCCTTAATTATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134887711_1134887714 9 Left 1134887711 16:17808607-17808629 CCATTGGGCTGGTTTCAGTCTCT No data
Right 1134887714 16:17808639-17808661 TTATCAGTTCCTTAATTATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134887714 Original CRISPR TTATCAGTTCCTTAATTATG GGG Intergenic
No off target data available for this crispr