ID: 1134888662

View in Genome Browser
Species Human (GRCh38)
Location 16:17818707-17818729
Sequence ATTATAGCTGGGCCCCTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134888662_1134888666 0 Left 1134888662 16:17818707-17818729 CCATGGAGGGGCCCAGCTATAAT No data
Right 1134888666 16:17818730-17818752 CTAATACCAGCAGTGAGTATGGG No data
1134888662_1134888667 1 Left 1134888662 16:17818707-17818729 CCATGGAGGGGCCCAGCTATAAT No data
Right 1134888667 16:17818731-17818753 TAATACCAGCAGTGAGTATGGGG No data
1134888662_1134888671 6 Left 1134888662 16:17818707-17818729 CCATGGAGGGGCCCAGCTATAAT No data
Right 1134888671 16:17818736-17818758 CCAGCAGTGAGTATGGGGGTGGG No data
1134888662_1134888668 2 Left 1134888662 16:17818707-17818729 CCATGGAGGGGCCCAGCTATAAT No data
Right 1134888668 16:17818732-17818754 AATACCAGCAGTGAGTATGGGGG No data
1134888662_1134888673 26 Left 1134888662 16:17818707-17818729 CCATGGAGGGGCCCAGCTATAAT No data
Right 1134888673 16:17818756-17818778 GGGAGTAAGAAGAAGAGGTGAGG No data
1134888662_1134888669 5 Left 1134888662 16:17818707-17818729 CCATGGAGGGGCCCAGCTATAAT No data
Right 1134888669 16:17818735-17818757 ACCAGCAGTGAGTATGGGGGTGG No data
1134888662_1134888665 -1 Left 1134888662 16:17818707-17818729 CCATGGAGGGGCCCAGCTATAAT No data
Right 1134888665 16:17818729-17818751 TCTAATACCAGCAGTGAGTATGG No data
1134888662_1134888672 21 Left 1134888662 16:17818707-17818729 CCATGGAGGGGCCCAGCTATAAT No data
Right 1134888672 16:17818751-17818773 GGGGTGGGAGTAAGAAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134888662 Original CRISPR ATTATAGCTGGGCCCCTCCA TGG (reversed) Intergenic
No off target data available for this crispr