ID: 1134890054

View in Genome Browser
Species Human (GRCh38)
Location 16:17832982-17833004
Sequence ATGTTCCTCTTTAGCATGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134890054_1134890057 19 Left 1134890054 16:17832982-17833004 CCATACATGCTAAAGAGGAACAT No data
Right 1134890057 16:17833024-17833046 CTAAGCCAGGATGATTAATTTGG No data
1134890054_1134890055 6 Left 1134890054 16:17832982-17833004 CCATACATGCTAAAGAGGAACAT No data
Right 1134890055 16:17833011-17833033 TTAGCATTCCAAGCTAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134890054 Original CRISPR ATGTTCCTCTTTAGCATGTA TGG (reversed) Intergenic
No off target data available for this crispr