ID: 1134900377

View in Genome Browser
Species Human (GRCh38)
Location 16:17932644-17932666
Sequence GGTGAGGCCCACAGGCCTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134900377_1134900385 29 Left 1134900377 16:17932644-17932666 CCTATAGGCCTGTGGGCCTCACC No data
Right 1134900385 16:17932696-17932718 ACCTGTAAGTCAATAGTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134900377 Original CRISPR GGTGAGGCCCACAGGCCTAT AGG (reversed) Intergenic
No off target data available for this crispr