ID: 1134901770

View in Genome Browser
Species Human (GRCh38)
Location 16:17944578-17944600
Sequence GGTTGGGTTTCTGCAAAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134901770_1134901775 -10 Left 1134901770 16:17944578-17944600 CCACATTTTGCAGAAACCCAACC No data
Right 1134901775 16:17944591-17944613 AAACCCAACCCTGGTAGAGGGGG No data
1134901770_1134901785 9 Left 1134901770 16:17944578-17944600 CCACATTTTGCAGAAACCCAACC No data
Right 1134901785 16:17944610-17944632 GGGGTTTGGGGAGTGATATGGGG No data
1134901770_1134901784 8 Left 1134901770 16:17944578-17944600 CCACATTTTGCAGAAACCCAACC No data
Right 1134901784 16:17944609-17944631 GGGGGTTTGGGGAGTGATATGGG No data
1134901770_1134901786 29 Left 1134901770 16:17944578-17944600 CCACATTTTGCAGAAACCCAACC No data
Right 1134901786 16:17944630-17944652 GGGAAATAGAATAAACTTCCAGG No data
1134901770_1134901778 -5 Left 1134901770 16:17944578-17944600 CCACATTTTGCAGAAACCCAACC No data
Right 1134901778 16:17944596-17944618 CAACCCTGGTAGAGGGGGTTTGG No data
1134901770_1134901780 -3 Left 1134901770 16:17944578-17944600 CCACATTTTGCAGAAACCCAACC No data
Right 1134901780 16:17944598-17944620 ACCCTGGTAGAGGGGGTTTGGGG No data
1134901770_1134901783 7 Left 1134901770 16:17944578-17944600 CCACATTTTGCAGAAACCCAACC No data
Right 1134901783 16:17944608-17944630 AGGGGGTTTGGGGAGTGATATGG No data
1134901770_1134901779 -4 Left 1134901770 16:17944578-17944600 CCACATTTTGCAGAAACCCAACC No data
Right 1134901779 16:17944597-17944619 AACCCTGGTAGAGGGGGTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134901770 Original CRISPR GGTTGGGTTTCTGCAAAATG TGG (reversed) Intergenic
No off target data available for this crispr