ID: 1134904592

View in Genome Browser
Species Human (GRCh38)
Location 16:17969487-17969509
Sequence TAGGGTAGGAAGGAAGTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134904592_1134904599 9 Left 1134904592 16:17969487-17969509 CCTACAACTTCCTTCCTACCCTA No data
Right 1134904599 16:17969519-17969541 GCAGAAAAAAGTACTTACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134904592 Original CRISPR TAGGGTAGGAAGGAAGTTGT AGG (reversed) Intergenic
No off target data available for this crispr