ID: 1134904599

View in Genome Browser
Species Human (GRCh38)
Location 16:17969519-17969541
Sequence GCAGAAAAAAGTACTTACAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134904589_1134904599 24 Left 1134904589 16:17969472-17969494 CCCACATCAATGCCACCTACAAC No data
Right 1134904599 16:17969519-17969541 GCAGAAAAAAGTACTTACATAGG No data
1134904593_1134904599 -1 Left 1134904593 16:17969497-17969519 CCTTCCTACCCTAATCCTCCTTG No data
Right 1134904599 16:17969519-17969541 GCAGAAAAAAGTACTTACATAGG No data
1134904588_1134904599 28 Left 1134904588 16:17969468-17969490 CCTTCCCACATCAATGCCACCTA No data
Right 1134904599 16:17969519-17969541 GCAGAAAAAAGTACTTACATAGG No data
1134904592_1134904599 9 Left 1134904592 16:17969487-17969509 CCTACAACTTCCTTCCTACCCTA No data
Right 1134904599 16:17969519-17969541 GCAGAAAAAAGTACTTACATAGG No data
1134904596_1134904599 -10 Left 1134904596 16:17969506-17969528 CCTAATCCTCCTTGCAGAAAAAA No data
Right 1134904599 16:17969519-17969541 GCAGAAAAAAGTACTTACATAGG No data
1134904590_1134904599 23 Left 1134904590 16:17969473-17969495 CCACATCAATGCCACCTACAACT No data
Right 1134904599 16:17969519-17969541 GCAGAAAAAAGTACTTACATAGG No data
1134904587_1134904599 29 Left 1134904587 16:17969467-17969489 CCCTTCCCACATCAATGCCACCT No data
Right 1134904599 16:17969519-17969541 GCAGAAAAAAGTACTTACATAGG No data
1134904586_1134904599 30 Left 1134904586 16:17969466-17969488 CCCCTTCCCACATCAATGCCACC No data
Right 1134904599 16:17969519-17969541 GCAGAAAAAAGTACTTACATAGG No data
1134904594_1134904599 -5 Left 1134904594 16:17969501-17969523 CCTACCCTAATCCTCCTTGCAGA No data
Right 1134904599 16:17969519-17969541 GCAGAAAAAAGTACTTACATAGG No data
1134904595_1134904599 -9 Left 1134904595 16:17969505-17969527 CCCTAATCCTCCTTGCAGAAAAA No data
Right 1134904599 16:17969519-17969541 GCAGAAAAAAGTACTTACATAGG No data
1134904591_1134904599 12 Left 1134904591 16:17969484-17969506 CCACCTACAACTTCCTTCCTACC No data
Right 1134904599 16:17969519-17969541 GCAGAAAAAAGTACTTACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134904599 Original CRISPR GCAGAAAAAAGTACTTACAT AGG Intergenic
No off target data available for this crispr