ID: 1134905745

View in Genome Browser
Species Human (GRCh38)
Location 16:17978224-17978246
Sequence GCTTCTCCTAAGTATAGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134905741_1134905745 4 Left 1134905741 16:17978197-17978219 CCACCACCCTCTAAGTCTGGGTT No data
Right 1134905745 16:17978224-17978246 GCTTCTCCTAAGTATAGATCTGG No data
1134905742_1134905745 1 Left 1134905742 16:17978200-17978222 CCACCCTCTAAGTCTGGGTTAGA No data
Right 1134905745 16:17978224-17978246 GCTTCTCCTAAGTATAGATCTGG No data
1134905738_1134905745 27 Left 1134905738 16:17978174-17978196 CCTCTGAGAAGATTCGTTTAACT No data
Right 1134905745 16:17978224-17978246 GCTTCTCCTAAGTATAGATCTGG No data
1134905743_1134905745 -2 Left 1134905743 16:17978203-17978225 CCCTCTAAGTCTGGGTTAGATGC No data
Right 1134905745 16:17978224-17978246 GCTTCTCCTAAGTATAGATCTGG No data
1134905744_1134905745 -3 Left 1134905744 16:17978204-17978226 CCTCTAAGTCTGGGTTAGATGCT No data
Right 1134905745 16:17978224-17978246 GCTTCTCCTAAGTATAGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134905745 Original CRISPR GCTTCTCCTAAGTATAGATC TGG Intergenic
No off target data available for this crispr