ID: 1134906084

View in Genome Browser
Species Human (GRCh38)
Location 16:17981027-17981049
Sequence GAAGTTTCTCACATTCAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134906079_1134906084 3 Left 1134906079 16:17981001-17981023 CCACCCCAGGGTAATCTTCAGCA No data
Right 1134906084 16:17981027-17981049 GAAGTTTCTCACATTCAAAATGG No data
1134906081_1134906084 0 Left 1134906081 16:17981004-17981026 CCCCAGGGTAATCTTCAGCAGGT No data
Right 1134906084 16:17981027-17981049 GAAGTTTCTCACATTCAAAATGG No data
1134906082_1134906084 -1 Left 1134906082 16:17981005-17981027 CCCAGGGTAATCTTCAGCAGGTG No data
Right 1134906084 16:17981027-17981049 GAAGTTTCTCACATTCAAAATGG No data
1134906075_1134906084 29 Left 1134906075 16:17980975-17980997 CCTGAAATGTCCTTATGTTTTAT No data
Right 1134906084 16:17981027-17981049 GAAGTTTCTCACATTCAAAATGG No data
1134906076_1134906084 19 Left 1134906076 16:17980985-17981007 CCTTATGTTTTATTCACCACCCC No data
Right 1134906084 16:17981027-17981049 GAAGTTTCTCACATTCAAAATGG No data
1134906083_1134906084 -2 Left 1134906083 16:17981006-17981028 CCAGGGTAATCTTCAGCAGGTGA No data
Right 1134906084 16:17981027-17981049 GAAGTTTCTCACATTCAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134906084 Original CRISPR GAAGTTTCTCACATTCAAAA TGG Intergenic
No off target data available for this crispr