ID: 1134906950

View in Genome Browser
Species Human (GRCh38)
Location 16:17988023-17988045
Sequence CCTCATGTTCCCTAGCTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134906943_1134906950 14 Left 1134906943 16:17987986-17988008 CCTTCTCTCTTTTATTTTCATAA No data
Right 1134906950 16:17988023-17988045 CCTCATGTTCCCTAGCTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134906950 Original CRISPR CCTCATGTTCCCTAGCTTGA GGG Intergenic
No off target data available for this crispr