ID: 1134908680

View in Genome Browser
Species Human (GRCh38)
Location 16:18004540-18004562
Sequence ATATTCCAGCAGAAGTGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134908675_1134908680 9 Left 1134908675 16:18004508-18004530 CCAGGCAGATAGATGAGGAAATG No data
Right 1134908680 16:18004540-18004562 ATATTCCAGCAGAAGTGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134908680 Original CRISPR ATATTCCAGCAGAAGTGTGA GGG Intergenic
No off target data available for this crispr