ID: 1134918138

View in Genome Browser
Species Human (GRCh38)
Location 16:18090581-18090603
Sequence TTGGCTCTTCACTGGCATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134918138_1134918143 5 Left 1134918138 16:18090581-18090603 CCCAGATGCCAGTGAAGAGCCAA No data
Right 1134918143 16:18090609-18090631 AAAGCAAGCCTTTCTAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134918138 Original CRISPR TTGGCTCTTCACTGGCATCT GGG (reversed) Intergenic
No off target data available for this crispr