ID: 1134918143

View in Genome Browser
Species Human (GRCh38)
Location 16:18090609-18090631
Sequence AAAGCAAGCCTTTCTAAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134918138_1134918143 5 Left 1134918138 16:18090581-18090603 CCCAGATGCCAGTGAAGAGCCAA No data
Right 1134918143 16:18090609-18090631 AAAGCAAGCCTTTCTAAAGATGG No data
1134918140_1134918143 -3 Left 1134918140 16:18090589-18090611 CCAGTGAAGAGCCAAGCCTGAAA No data
Right 1134918143 16:18090609-18090631 AAAGCAAGCCTTTCTAAAGATGG No data
1134918137_1134918143 12 Left 1134918137 16:18090574-18090596 CCAAGTTCCCAGATGCCAGTGAA No data
Right 1134918143 16:18090609-18090631 AAAGCAAGCCTTTCTAAAGATGG No data
1134918139_1134918143 4 Left 1134918139 16:18090582-18090604 CCAGATGCCAGTGAAGAGCCAAG No data
Right 1134918143 16:18090609-18090631 AAAGCAAGCCTTTCTAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134918143 Original CRISPR AAAGCAAGCCTTTCTAAAGA TGG Intergenic
No off target data available for this crispr