ID: 1134925080

View in Genome Browser
Species Human (GRCh38)
Location 16:18152300-18152322
Sequence ATTGCTGCGGGGGTGGAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134925080_1134925087 8 Left 1134925080 16:18152300-18152322 CCTCACTCCACCCCCGCAGCAAT No data
Right 1134925087 16:18152331-18152353 TGTCAGTCAATCCCTTTTTTGGG No data
1134925080_1134925086 7 Left 1134925080 16:18152300-18152322 CCTCACTCCACCCCCGCAGCAAT No data
Right 1134925086 16:18152330-18152352 ATGTCAGTCAATCCCTTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134925080 Original CRISPR ATTGCTGCGGGGGTGGAGTG AGG (reversed) Intergenic