ID: 1134925080 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:18152300-18152322 |
| Sequence | ATTGCTGCGGGGGTGGAGTG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1134925080_1134925087 | 8 | Left | 1134925080 | 16:18152300-18152322 | CCTCACTCCACCCCCGCAGCAAT | No data | ||
| Right | 1134925087 | 16:18152331-18152353 | TGTCAGTCAATCCCTTTTTTGGG | No data | ||||
| 1134925080_1134925086 | 7 | Left | 1134925080 | 16:18152300-18152322 | CCTCACTCCACCCCCGCAGCAAT | No data | ||
| Right | 1134925086 | 16:18152330-18152352 | ATGTCAGTCAATCCCTTTTTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1134925080 | Original CRISPR | ATTGCTGCGGGGGTGGAGTG AGG (reversed) | Intergenic | ||