ID: 1134932952

View in Genome Browser
Species Human (GRCh38)
Location 16:18222400-18222422
Sequence ACGCCCTACCCAAGGTCGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134932952_1134932954 -10 Left 1134932952 16:18222400-18222422 CCATGCGACCTTGGGTAGGGCGT No data
Right 1134932954 16:18222413-18222435 GGTAGGGCGTTCCGCCACTCAGG No data
1134932952_1134932963 28 Left 1134932952 16:18222400-18222422 CCATGCGACCTTGGGTAGGGCGT No data
Right 1134932963 16:18222451-18222473 ACAAACAAGGGGAATAGACACGG No data
1134932952_1134932957 15 Left 1134932952 16:18222400-18222422 CCATGCGACCTTGGGTAGGGCGT No data
Right 1134932957 16:18222438-18222460 AGTTTCCCCATCTACAAACAAGG No data
1134932952_1134932959 17 Left 1134932952 16:18222400-18222422 CCATGCGACCTTGGGTAGGGCGT No data
Right 1134932959 16:18222440-18222462 TTTCCCCATCTACAAACAAGGGG No data
1134932952_1134932958 16 Left 1134932952 16:18222400-18222422 CCATGCGACCTTGGGTAGGGCGT No data
Right 1134932958 16:18222439-18222461 GTTTCCCCATCTACAAACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134932952 Original CRISPR ACGCCCTACCCAAGGTCGCA TGG (reversed) Intergenic
No off target data available for this crispr