ID: 1134935805

View in Genome Browser
Species Human (GRCh38)
Location 16:18244666-18244688
Sequence CCTCATTAGCACATGAATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134935805_1134935807 -6 Left 1134935805 16:18244666-18244688 CCAGCATTCATGTGCTAATGAGG No data
Right 1134935807 16:18244683-18244705 ATGAGGCTCACTACTAGTATTGG No data
1134935805_1134935808 2 Left 1134935805 16:18244666-18244688 CCAGCATTCATGTGCTAATGAGG No data
Right 1134935808 16:18244691-18244713 CACTACTAGTATTGGAAAGATGG No data
1134935805_1134935809 3 Left 1134935805 16:18244666-18244688 CCAGCATTCATGTGCTAATGAGG No data
Right 1134935809 16:18244692-18244714 ACTACTAGTATTGGAAAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134935805 Original CRISPR CCTCATTAGCACATGAATGC TGG (reversed) Intergenic
No off target data available for this crispr