ID: 1134935908

View in Genome Browser
Species Human (GRCh38)
Location 16:18245702-18245724
Sequence CAACATAAGGAAAAGAAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134935902_1134935908 16 Left 1134935902 16:18245663-18245685 CCATAGACAATGTCTCTGGGCCT No data
Right 1134935908 16:18245702-18245724 CAACATAAGGAAAAGAAGGCCGG No data
1134935904_1134935908 -4 Left 1134935904 16:18245683-18245705 CCTTTTGTGGCAGAAAAACCAAC No data
Right 1134935908 16:18245702-18245724 CAACATAAGGAAAAGAAGGCCGG No data
1134935899_1134935908 25 Left 1134935899 16:18245654-18245676 CCAAACGTTCCATAGACAATGTC No data
Right 1134935908 16:18245702-18245724 CAACATAAGGAAAAGAAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134935908 Original CRISPR CAACATAAGGAAAAGAAGGC CGG Intergenic
No off target data available for this crispr