ID: 1134937875

View in Genome Browser
Species Human (GRCh38)
Location 16:18262124-18262146
Sequence CCTCATATGTGGAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134937875_1134937880 2 Left 1134937875 16:18262124-18262146 CCTTCCACCTTCCACATATGAGG No data
Right 1134937880 16:18262149-18262171 ACAGCATTCATGCCCTCCAGAGG No data
1134937875_1134937881 10 Left 1134937875 16:18262124-18262146 CCTTCCACCTTCCACATATGAGG No data
Right 1134937881 16:18262157-18262179 CATGCCCTCCAGAGGACACAAGG No data
1134937875_1134937885 29 Left 1134937875 16:18262124-18262146 CCTTCCACCTTCCACATATGAGG No data
Right 1134937885 16:18262176-18262198 AAGGCACCACCTTAGAAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134937875 Original CRISPR CCTCATATGTGGAAGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr