ID: 1134937881

View in Genome Browser
Species Human (GRCh38)
Location 16:18262157-18262179
Sequence CATGCCCTCCAGAGGACACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134937877_1134937881 6 Left 1134937877 16:18262128-18262150 CCACCTTCCACATATGAGGATAC No data
Right 1134937881 16:18262157-18262179 CATGCCCTCCAGAGGACACAAGG No data
1134937878_1134937881 3 Left 1134937878 16:18262131-18262153 CCTTCCACATATGAGGATACAGC No data
Right 1134937881 16:18262157-18262179 CATGCCCTCCAGAGGACACAAGG No data
1134937872_1134937881 19 Left 1134937872 16:18262115-18262137 CCCTTTTGCCCTTCCACCTTCCA No data
Right 1134937881 16:18262157-18262179 CATGCCCTCCAGAGGACACAAGG No data
1134937875_1134937881 10 Left 1134937875 16:18262124-18262146 CCTTCCACCTTCCACATATGAGG No data
Right 1134937881 16:18262157-18262179 CATGCCCTCCAGAGGACACAAGG No data
1134937879_1134937881 -1 Left 1134937879 16:18262135-18262157 CCACATATGAGGATACAGCATTC No data
Right 1134937881 16:18262157-18262179 CATGCCCTCCAGAGGACACAAGG No data
1134937873_1134937881 18 Left 1134937873 16:18262116-18262138 CCTTTTGCCCTTCCACCTTCCAC 0: 5
1: 12
2: 32
3: 172
4: 951
Right 1134937881 16:18262157-18262179 CATGCCCTCCAGAGGACACAAGG No data
1134937874_1134937881 11 Left 1134937874 16:18262123-18262145 CCCTTCCACCTTCCACATATGAG No data
Right 1134937881 16:18262157-18262179 CATGCCCTCCAGAGGACACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134937881 Original CRISPR CATGCCCTCCAGAGGACACA AGG Intergenic
No off target data available for this crispr