ID: 1134937885

View in Genome Browser
Species Human (GRCh38)
Location 16:18262176-18262198
Sequence AAGGCACCACCTTAGAAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134937883_1134937885 -9 Left 1134937883 16:18262162-18262184 CCTCCAGAGGACACAAGGCACCA No data
Right 1134937885 16:18262176-18262198 AAGGCACCACCTTAGAAGCAAGG No data
1134937874_1134937885 30 Left 1134937874 16:18262123-18262145 CCCTTCCACCTTCCACATATGAG No data
Right 1134937885 16:18262176-18262198 AAGGCACCACCTTAGAAGCAAGG No data
1134937875_1134937885 29 Left 1134937875 16:18262124-18262146 CCTTCCACCTTCCACATATGAGG No data
Right 1134937885 16:18262176-18262198 AAGGCACCACCTTAGAAGCAAGG No data
1134937877_1134937885 25 Left 1134937877 16:18262128-18262150 CCACCTTCCACATATGAGGATAC No data
Right 1134937885 16:18262176-18262198 AAGGCACCACCTTAGAAGCAAGG No data
1134937882_1134937885 -8 Left 1134937882 16:18262161-18262183 CCCTCCAGAGGACACAAGGCACC No data
Right 1134937885 16:18262176-18262198 AAGGCACCACCTTAGAAGCAAGG No data
1134937878_1134937885 22 Left 1134937878 16:18262131-18262153 CCTTCCACATATGAGGATACAGC No data
Right 1134937885 16:18262176-18262198 AAGGCACCACCTTAGAAGCAAGG No data
1134937879_1134937885 18 Left 1134937879 16:18262135-18262157 CCACATATGAGGATACAGCATTC No data
Right 1134937885 16:18262176-18262198 AAGGCACCACCTTAGAAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134937885 Original CRISPR AAGGCACCACCTTAGAAGCA AGG Intergenic
No off target data available for this crispr