ID: 1134947428

View in Genome Browser
Species Human (GRCh38)
Location 16:18336506-18336528
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 7, 1: 0, 2: 0, 3: 13, 4: 93}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134947428_1134947439 13 Left 1134947428 16:18336506-18336528 CCCTTCCCGAGCAGCCTTTGGTG 0: 7
1: 0
2: 0
3: 13
4: 93
Right 1134947439 16:18336542-18336564 CTGGCTGCAGCACTGGAAAGTGG 0: 7
1: 0
2: 6
3: 22
4: 329
1134947428_1134947436 6 Left 1134947428 16:18336506-18336528 CCCTTCCCGAGCAGCCTTTGGTG 0: 7
1: 0
2: 0
3: 13
4: 93
Right 1134947436 16:18336535-18336557 TTTCCCTCTGGCTGCAGCACTGG 0: 7
1: 0
2: 2
3: 29
4: 305
1134947428_1134947440 16 Left 1134947428 16:18336506-18336528 CCCTTCCCGAGCAGCCTTTGGTG 0: 7
1: 0
2: 0
3: 13
4: 93
Right 1134947440 16:18336545-18336567 GCTGCAGCACTGGAAAGTGGCGG 0: 7
1: 0
2: 3
3: 17
4: 295
1134947428_1134947441 22 Left 1134947428 16:18336506-18336528 CCCTTCCCGAGCAGCCTTTGGTG 0: 7
1: 0
2: 0
3: 13
4: 93
Right 1134947441 16:18336551-18336573 GCACTGGAAAGTGGCGGCCCTGG 0: 5
1: 1
2: 0
3: 17
4: 147
1134947428_1134947443 28 Left 1134947428 16:18336506-18336528 CCCTTCCCGAGCAGCCTTTGGTG 0: 7
1: 0
2: 0
3: 13
4: 93
Right 1134947443 16:18336557-18336579 GAAAGTGGCGGCCCTGGGCATGG 0: 5
1: 2
2: 1
3: 26
4: 275
1134947428_1134947442 23 Left 1134947428 16:18336506-18336528 CCCTTCCCGAGCAGCCTTTGGTG 0: 7
1: 0
2: 0
3: 13
4: 93
Right 1134947442 16:18336552-18336574 CACTGGAAAGTGGCGGCCCTGGG 0: 6
1: 1
2: 1
3: 16
4: 154
1134947428_1134947434 -6 Left 1134947428 16:18336506-18336528 CCCTTCCCGAGCAGCCTTTGGTG 0: 7
1: 0
2: 0
3: 13
4: 93
Right 1134947434 16:18336523-18336545 TTGGTGGACGCCTTTCCCTCTGG 0: 7
1: 0
2: 4
3: 16
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134947428 Original CRISPR CACCAAAGGCTGCTCGGGAA GGG (reversed) Intronic
900203695 1:1422109-1422131 CTCCAGCGGCTGCACGGGAAAGG + Intergenic
901467134 1:9429416-9429438 CACCACAGGGTTCTCAGGAAGGG - Intergenic
903222362 1:21875956-21875978 CACCAACGGCTGCCCGTGCAGGG + Exonic
907257561 1:53191316-53191338 CACCACAGACTGCTGGGGAAAGG + Intergenic
907407871 1:54264769-54264791 CACAGAAGGCTGCTGAGGAAAGG + Intronic
908169325 1:61488900-61488922 CACCAAAGGGTGGTGAGGAAAGG + Intergenic
911060494 1:93743920-93743942 CATAAAAGGATGCTAGGGAAGGG + Intronic
912263854 1:108134615-108134637 CTACAAGGGCTGCTCAGGAAAGG + Exonic
912960318 1:114190155-114190177 CACTGAAGGCTGCTGCGGAAAGG + Intergenic
915596332 1:156898367-156898389 CGCCAGAGGCTGGGCGGGAAAGG - Intronic
917187620 1:172378242-172378264 CACCAGAGGCTGAGCTGGAATGG - Intronic
1067916449 10:50404623-50404645 CACCAAATTCTTCTCTGGAAAGG - Intronic
1076342849 10:129761428-129761450 CACCAAAGGCTGGTGGGGGAGGG - Intronic
1076608315 10:131703736-131703758 CACCACAGGCTGCTCGGTGCAGG - Intergenic
1077777541 11:5288177-5288199 AAGCAAACCCTGCTCGGGAATGG + Intronic
1080418515 11:32091129-32091151 CAACAGCGGCAGCTCGGGAATGG - Exonic
1081741680 11:45445304-45445326 CACAAAAGGCTGCCTGGCAATGG - Intergenic
1081814231 11:45929631-45929653 GTCCAAAGGCTGCTGGGGAAGGG + Intronic
1084715750 11:70872491-70872513 CACCAAGCGCTTCTAGGGAAGGG - Intronic
1088806649 11:113358840-113358862 CCCCAAAGGCTCTTGGGGAATGG - Intronic
1097675958 12:62602997-62603019 CCCCGAAGGGTGCTGGGGAACGG + Exonic
1101292556 12:103386715-103386737 CACCAAAAGCAACTGGGGAAAGG - Intronic
1101331571 12:103761661-103761683 CACCAAAGGAAGCGCTGGAAGGG + Intronic
1101651028 12:106677233-106677255 CAGCTAAGGCTGCATGGGAAGGG + Intronic
1103903726 12:124316640-124316662 CCCCAGAGGCTGCTGGGGACAGG + Intergenic
1107720738 13:43245681-43245703 CATCAAAGGCTGCTGGGAAAGGG - Intronic
1107943019 13:45391385-45391407 CAACAGCGGCAGCTCGGGAATGG + Intergenic
1108493762 13:51005169-51005191 AATCCAAGGCTGCTGGGGAAAGG + Intergenic
1111746277 13:92273600-92273622 CACCAAAGCCTGTTCAGGGAGGG - Intronic
1113565702 13:111318484-111318506 CACCAAGGGCTTCTAGGGAGAGG - Intronic
1118870525 14:69737372-69737394 GACCCAAGGATGCTCGGGAATGG - Intronic
1123754981 15:23390550-23390572 CACCAAATGTTGCTAAGGAAGGG - Intergenic
1127709741 15:61584714-61584736 CACCAAAGGCGGCCCTGGCATGG - Intergenic
1127914680 15:63445674-63445696 CACAAAAGGCTGCTGGGTCATGG - Intergenic
1128153024 15:65375326-65375348 CACTATAGGCTGCCCGGGGACGG + Exonic
1130879166 15:88040370-88040392 CACCAAAGGCTTCTGCAGAATGG - Intronic
1130963803 15:88682332-88682354 CACCAAAGGCAGATGGGGAAGGG - Intergenic
1132116210 15:99138179-99138201 CAGCAAAGGCTGGATGGGAACGG - Intronic
1132867223 16:2099516-2099538 CACCAAAGGCTGCTCGGGAAGGG - Intronic
1134461395 16:14432446-14432468 CACCAAATGTTGCTAAGGAAGGG + Intergenic
1134524552 16:14933599-14933621 CACCAAAGGCTGCTCGGGAAGGG + Intronic
1134548351 16:15127342-15127364 CACCAAAGGCTGCTCGGGAAGGG - Intronic
1134712141 16:16332086-16332108 CACCAAAGGCTGCTCGGGAAGGG + Intergenic
1134719998 16:16375379-16375401 CACCAAAGGCTGCTCGGGAAGGG + Intergenic
1134947428 16:18336506-18336528 CACCAAAGGCTGCTCGGGAAGGG - Intronic
1134954688 16:18376608-18376630 CACCAAAGGCTGCTCGGGAAGGG - Intergenic
1135894710 16:26388358-26388380 CAAAACAGGCTGCTCGGGAATGG - Intergenic
1136484452 16:30562279-30562301 CAGCAAAGGCTGCAGGGGAGGGG + Intergenic
1138281262 16:55773634-55773656 CACCAATGGCTGAGCAGGAAGGG + Intergenic
1138287277 16:55820227-55820249 CACCAATGGCTGAGCAGGAAGGG - Intronic
1138952832 16:61934202-61934224 CACACGAGGCTGCTTGGGAAAGG + Intronic
1141757109 16:85998578-85998600 TCCCAAAGGCCGCTCAGGAAAGG - Intergenic
1151804653 17:76397880-76397902 CACCGATGGCTGCTGGGCAAAGG + Exonic
1153696012 18:7642646-7642668 CACATAATGCTGCTCGGAAAAGG - Intronic
1160567659 18:79797342-79797364 CCCCAAAGGCTGCTTTGGAGTGG + Intergenic
1160580290 18:79879873-79879895 CACCAAAGGCAGGACAGGAAGGG + Intronic
1163824259 19:19514264-19514286 CACCCACGGCTGGTTGGGAAGGG + Exonic
1165243077 19:34482363-34482385 CACCGAAGGCGGCCCGGGACCGG - Exonic
925063562 2:911965-911987 CACCGAAGGCCGCTGTGGAAGGG + Intergenic
925918596 2:8624373-8624395 CACCAAGGGCTGCTCTAGCAGGG + Intergenic
928466500 2:31527655-31527677 CACCAGAGGCAGAGCGGGAATGG - Intronic
929596005 2:43176468-43176490 CAGCAAAGGCTTCTGAGGAAGGG - Intergenic
932099831 2:68888721-68888743 CACCACAAGCTGGTTGGGAAGGG - Intergenic
1172080129 20:32333864-32333886 CACCAGAGACTGCTTGGAAAGGG - Exonic
1172786872 20:37474391-37474413 CACCCAAGGCTGCTCCGACAAGG + Intergenic
1175876666 20:62233296-62233318 CCCCAGAGGCTGCTAGGCAAAGG - Intronic
1176033088 20:63023265-63023287 CCCCAAAGGCTGCTCGGAACCGG + Intergenic
1178372393 21:32037328-32037350 CACCAAGGGCAGCTTGGGAAGGG + Intronic
1179244228 21:39616680-39616702 CACCAAAGGAAGCTCTGGGAAGG - Intronic
950881006 3:16322619-16322641 CACCACAGGCTGCTCAGGGTGGG + Intronic
954434843 3:50490498-50490520 CACCAAGGGCTGCTCTGGGGAGG - Intronic
956562465 3:70595389-70595411 CACCAAATGCTGCTATGGAGGGG - Intergenic
959576866 3:107943924-107943946 CAGCAAAGGCTGCTAGGGGAAGG - Intergenic
960277415 3:115743841-115743863 CACCAAGGACTGCCCTGGAAAGG + Intergenic
964970278 3:162551921-162551943 CCCCAAAGGTAGTTCGGGAAAGG + Intergenic
966225719 3:177595815-177595837 AACCAAAGGATGATTGGGAATGG - Intergenic
966731930 3:183158713-183158735 AACCAAAGGCTGTCTGGGAAGGG - Intronic
968422871 4:499787-499809 ACCCAAAGGCTGCTCAGGAAAGG - Intronic
968887120 4:3341062-3341084 CACGAGAGGATGCTCGGGGAGGG - Intronic
969469640 4:7380042-7380064 CACCAAAGGTTGCTCAACAATGG + Intronic
969685437 4:8671526-8671548 CCCCAGAGACTGCTCTGGAAAGG - Intergenic
971154181 4:24064444-24064466 CACCACAGGCTGAGGGGGAAAGG + Intergenic
981383525 4:144100307-144100329 TACCAGAGGCTGCTGGGGTAGGG + Intergenic
986361778 5:6985347-6985369 TACCAAATGCTGCTGAGGAATGG - Intergenic
991400269 5:66244464-66244486 CTCCAAAGGCTGCCAGGGGAAGG - Intergenic
993458768 5:88157785-88157807 CACCAAATGCTGCTTTGTAAAGG - Intergenic
994056909 5:95427231-95427253 CCCCAAAGACTGCTCAGGAGTGG - Intronic
1002104669 5:176874199-176874221 CGCCAAGGGCTGCTGGGGCAGGG + Intronic
1002350581 5:178580709-178580731 CACTAAATGCTGCTCAAGAAAGG + Intronic
1002573394 5:180157012-180157034 CACCAAATGCTGGTAAGGAAGGG + Intronic
1005872966 6:29989940-29989962 GATCAATGGCTGCTGGGGAAAGG + Intergenic
1007719724 6:43877955-43877977 CACCAGATGCTGCTGGGGAGGGG + Intergenic
1010064266 6:71662844-71662866 GACCAAAAGCTGGTGGGGAAGGG + Intergenic
1012442161 6:99270655-99270677 CATGAAAGGCAGCTCCGGAAGGG - Intergenic
1019501832 7:1368680-1368702 CACCGGAGGCCGCTCAGGAACGG - Intergenic
1021049207 7:15961587-15961609 CACCAAAGCCTGTTGAGGAATGG + Intergenic
1022113316 7:27244192-27244214 CACCAAAGGCTAATGGGAAAGGG + Intronic
1022360119 7:29649499-29649521 CACCAAAGGCTGCACGCTCAGGG + Intergenic
1024505365 7:50158066-50158088 CCCCAGAGGCTGCTGGGGGAGGG - Intronic
1026883581 7:73922524-73922546 CACCAAAGGGTGCTTAGGAAGGG - Intergenic
1030656099 7:112169667-112169689 CACTAAAGGCTACACGAGAAAGG - Intronic
1031421772 7:121561377-121561399 GACAAAAGGCAGCTCAGGAAAGG - Intergenic
1034435744 7:151062073-151062095 CACCCAAGGCTGCCCAGGGAGGG - Intronic
1034545337 7:151785418-151785440 CAGCAAAGACTGCCAGGGAATGG - Intronic
1049681398 8:143920161-143920183 CAGAAAAGGCTGCTCGGGCCCGG - Exonic
1055532127 9:77194684-77194706 CCCCAAATGCTCCTGGGGAAAGG - Intronic
1055691678 9:78838605-78838627 CAGCAATTGCTTCTCGGGAATGG - Intergenic
1056526814 9:87450838-87450860 CACCAAGGGCTGTTGGGGAGTGG - Intergenic
1062612501 9:137381453-137381475 CACCACAGGCTGCTGGGCAGTGG + Intronic
1062710814 9:137974262-137974284 CAGGCAGGGCTGCTCGGGAATGG - Intronic
1186428502 X:9484434-9484456 CACCAATGGCTGCCTGGGAAAGG - Intronic
1188533188 X:31164833-31164855 CAGCAAGGGCAGGTCGGGAAGGG - Intronic
1197862389 X:130984664-130984686 CAGCAAAGCCTGCAGGGGAAGGG + Intergenic