ID: 1134947565

View in Genome Browser
Species Human (GRCh38)
Location 16:18337107-18337129
Sequence CCACCCTGCCCAACCTCCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134947555_1134947565 23 Left 1134947555 16:18337061-18337083 CCTAGAAGGCAGGGAGGGCCGCA No data
Right 1134947565 16:18337107-18337129 CCACCCTGCCCAACCTCCCACGG No data
1134947560_1134947565 5 Left 1134947560 16:18337079-18337101 CCGCACTGCAGGAGGCCACGGGG No data
Right 1134947565 16:18337107-18337129 CCACCCTGCCCAACCTCCCACGG No data
1134947563_1134947565 -10 Left 1134947563 16:18337094-18337116 CCACGGGGCAGGACCACCCTGCC No data
Right 1134947565 16:18337107-18337129 CCACCCTGCCCAACCTCCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134947565 Original CRISPR CCACCCTGCCCAACCTCCCA CGG Intergenic
No off target data available for this crispr