ID: 1134947939

View in Genome Browser
Species Human (GRCh38)
Location 16:18339231-18339253
Sequence GTCTTCACAGGAGCCGACAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134947939_1134947949 24 Left 1134947939 16:18339231-18339253 CCGCTGTCGGCTCCTGTGAAGAC No data
Right 1134947949 16:18339278-18339300 CGTGCAAGCTGTGCCTTCTCAGG No data
1134947939_1134947944 -2 Left 1134947939 16:18339231-18339253 CCGCTGTCGGCTCCTGTGAAGAC No data
Right 1134947944 16:18339252-18339274 ACACAGCCGCCGGGCCCAGGAGG No data
1134947939_1134947943 -5 Left 1134947939 16:18339231-18339253 CCGCTGTCGGCTCCTGTGAAGAC No data
Right 1134947943 16:18339249-18339271 AAGACACAGCCGCCGGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134947939 Original CRISPR GTCTTCACAGGAGCCGACAG CGG (reversed) Intergenic