ID: 1134947941

View in Genome Browser
Species Human (GRCh38)
Location 16:18339243-18339265
Sequence CCCGGCGGCTGTGTCTTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134947941_1134947949 12 Left 1134947941 16:18339243-18339265 CCTGTGAAGACACAGCCGCCGGG No data
Right 1134947949 16:18339278-18339300 CGTGCAAGCTGTGCCTTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134947941 Original CRISPR CCCGGCGGCTGTGTCTTCAC AGG (reversed) Intergenic
No off target data available for this crispr