ID: 1134947946

View in Genome Browser
Species Human (GRCh38)
Location 16:18339261-18339283
Sequence TGCACGTGACCTCCTGGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134947946_1134947951 15 Left 1134947946 16:18339261-18339283 CCGGGCCCAGGAGGTCACGTGCA No data
Right 1134947951 16:18339299-18339321 GGATAGAGCCGAGCCCACCCAGG No data
1134947946_1134947949 -6 Left 1134947946 16:18339261-18339283 CCGGGCCCAGGAGGTCACGTGCA No data
Right 1134947949 16:18339278-18339300 CGTGCAAGCTGTGCCTTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134947946 Original CRISPR TGCACGTGACCTCCTGGGCC CGG (reversed) Intergenic