ID: 1134947949

View in Genome Browser
Species Human (GRCh38)
Location 16:18339278-18339300
Sequence CGTGCAAGCTGTGCCTTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134947946_1134947949 -6 Left 1134947946 16:18339261-18339283 CCGGGCCCAGGAGGTCACGTGCA No data
Right 1134947949 16:18339278-18339300 CGTGCAAGCTGTGCCTTCTCAGG No data
1134947941_1134947949 12 Left 1134947941 16:18339243-18339265 CCTGTGAAGACACAGCCGCCGGG No data
Right 1134947949 16:18339278-18339300 CGTGCAAGCTGTGCCTTCTCAGG No data
1134947945_1134947949 -3 Left 1134947945 16:18339258-18339280 CCGCCGGGCCCAGGAGGTCACGT No data
Right 1134947949 16:18339278-18339300 CGTGCAAGCTGTGCCTTCTCAGG No data
1134947939_1134947949 24 Left 1134947939 16:18339231-18339253 CCGCTGTCGGCTCCTGTGAAGAC No data
Right 1134947949 16:18339278-18339300 CGTGCAAGCTGTGCCTTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134947949 Original CRISPR CGTGCAAGCTGTGCCTTCTC AGG Intergenic