ID: 1134947951

View in Genome Browser
Species Human (GRCh38)
Location 16:18339299-18339321
Sequence GGATAGAGCCGAGCCCACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134947946_1134947951 15 Left 1134947946 16:18339261-18339283 CCGGGCCCAGGAGGTCACGTGCA No data
Right 1134947951 16:18339299-18339321 GGATAGAGCCGAGCCCACCCAGG No data
1134947945_1134947951 18 Left 1134947945 16:18339258-18339280 CCGCCGGGCCCAGGAGGTCACGT No data
Right 1134947951 16:18339299-18339321 GGATAGAGCCGAGCCCACCCAGG No data
1134947947_1134947951 10 Left 1134947947 16:18339266-18339288 CCCAGGAGGTCACGTGCAAGCTG No data
Right 1134947951 16:18339299-18339321 GGATAGAGCCGAGCCCACCCAGG No data
1134947948_1134947951 9 Left 1134947948 16:18339267-18339289 CCAGGAGGTCACGTGCAAGCTGT No data
Right 1134947951 16:18339299-18339321 GGATAGAGCCGAGCCCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134947951 Original CRISPR GGATAGAGCCGAGCCCACCC AGG Intergenic