ID: 1134948213

View in Genome Browser
Species Human (GRCh38)
Location 16:18340321-18340343
Sequence CACCGACGGAGGCCTGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134948206_1134948213 -8 Left 1134948206 16:18340306-18340328 CCAGGGTGACCACAGCACCGACG No data
Right 1134948213 16:18340321-18340343 CACCGACGGAGGCCTGGGGCTGG No data
1134948203_1134948213 10 Left 1134948203 16:18340288-18340310 CCACAGGGCTGCTGCTGTCCAGG 0: 1
1: 6
2: 5
3: 71
4: 516
Right 1134948213 16:18340321-18340343 CACCGACGGAGGCCTGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134948213 Original CRISPR CACCGACGGAGGCCTGGGGC TGG Intergenic
No off target data available for this crispr