ID: 1134949435

View in Genome Browser
Species Human (GRCh38)
Location 16:18344964-18344986
Sequence GGGGCTTCTGCCGAGCGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134949435_1134949454 29 Left 1134949435 16:18344964-18344986 CCCACCCGCTCGGCAGAAGCCCC No data
Right 1134949454 16:18345016-18345038 CACCTGCGGCCCAGCCTTAAGGG No data
1134949435_1134949449 3 Left 1134949435 16:18344964-18344986 CCCACCCGCTCGGCAGAAGCCCC No data
Right 1134949449 16:18344990-18345012 CCTGAGGAGCCCGGGGTGAACGG No data
1134949435_1134949443 -4 Left 1134949435 16:18344964-18344986 CCCACCCGCTCGGCAGAAGCCCC No data
Right 1134949443 16:18344983-18345005 CCCCCCGCCTGAGGAGCCCGGGG No data
1134949435_1134949441 -5 Left 1134949435 16:18344964-18344986 CCCACCCGCTCGGCAGAAGCCCC No data
Right 1134949441 16:18344982-18345004 GCCCCCCGCCTGAGGAGCCCGGG No data
1134949435_1134949440 -6 Left 1134949435 16:18344964-18344986 CCCACCCGCTCGGCAGAAGCCCC No data
Right 1134949440 16:18344981-18345003 AGCCCCCCGCCTGAGGAGCCCGG No data
1134949435_1134949453 28 Left 1134949435 16:18344964-18344986 CCCACCCGCTCGGCAGAAGCCCC No data
Right 1134949453 16:18345015-18345037 GCACCTGCGGCCCAGCCTTAAGG No data
1134949435_1134949452 15 Left 1134949435 16:18344964-18344986 CCCACCCGCTCGGCAGAAGCCCC No data
Right 1134949452 16:18345002-18345024 GGGGTGAACGGCTGCACCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134949435 Original CRISPR GGGGCTTCTGCCGAGCGGGT GGG (reversed) Intergenic
No off target data available for this crispr