ID: 1134952474

View in Genome Browser
Species Human (GRCh38)
Location 16:18359745-18359767
Sequence GATGGGGGCCCCACTGGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134952465_1134952474 -2 Left 1134952465 16:18359724-18359746 CCTCTGACACTTAGAATATTAGA No data
Right 1134952474 16:18359745-18359767 GATGGGGGCCCCACTGGGTGGGG No data
1134952464_1134952474 22 Left 1134952464 16:18359700-18359722 CCATTTGCTATTACAAATACGGA No data
Right 1134952474 16:18359745-18359767 GATGGGGGCCCCACTGGGTGGGG No data
1134952462_1134952474 23 Left 1134952462 16:18359699-18359721 CCCATTTGCTATTACAAATACGG No data
Right 1134952474 16:18359745-18359767 GATGGGGGCCCCACTGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134952474 Original CRISPR GATGGGGGCCCCACTGGGTG GGG Intergenic
No off target data available for this crispr