ID: 1134954688

View in Genome Browser
Species Human (GRCh38)
Location 16:18376608-18376630
Sequence CACCAAAGGCTGCTCGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134954688_1134954694 -6 Left 1134954688 16:18376608-18376630 CCCTTCCCGAGCAGCCTTTGGTG No data
Right 1134954694 16:18376625-18376647 TTGGTGGACGCCTTTCCCTCTGG No data
1134954688_1134954703 28 Left 1134954688 16:18376608-18376630 CCCTTCCCGAGCAGCCTTTGGTG No data
Right 1134954703 16:18376659-18376681 GAAAGTGGCGGCCCTGGGCATGG No data
1134954688_1134954699 13 Left 1134954688 16:18376608-18376630 CCCTTCCCGAGCAGCCTTTGGTG No data
Right 1134954699 16:18376644-18376666 CTGGCTGCAGCACTGGAAAGTGG No data
1134954688_1134954700 16 Left 1134954688 16:18376608-18376630 CCCTTCCCGAGCAGCCTTTGGTG No data
Right 1134954700 16:18376647-18376669 GCTGCAGCACTGGAAAGTGGCGG No data
1134954688_1134954702 23 Left 1134954688 16:18376608-18376630 CCCTTCCCGAGCAGCCTTTGGTG No data
Right 1134954702 16:18376654-18376676 CACTGGAAAGTGGCGGCCCTGGG No data
1134954688_1134954696 6 Left 1134954688 16:18376608-18376630 CCCTTCCCGAGCAGCCTTTGGTG No data
Right 1134954696 16:18376637-18376659 TTTCCCTCTGGCTGCAGCACTGG No data
1134954688_1134954701 22 Left 1134954688 16:18376608-18376630 CCCTTCCCGAGCAGCCTTTGGTG No data
Right 1134954701 16:18376653-18376675 GCACTGGAAAGTGGCGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134954688 Original CRISPR CACCAAAGGCTGCTCGGGAA GGG (reversed) Intergenic
No off target data available for this crispr