ID: 1134954824

View in Genome Browser
Species Human (GRCh38)
Location 16:18377209-18377231
Sequence CCACCCTGCCCAACCTCCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134954814_1134954824 23 Left 1134954814 16:18377163-18377185 CCTAGAAGGCAGGGAGGGCCGCA No data
Right 1134954824 16:18377209-18377231 CCACCCTGCCCAACCTCCCACGG No data
1134954819_1134954824 5 Left 1134954819 16:18377181-18377203 CCGCACTGCAGGAGGCCACGGGG No data
Right 1134954824 16:18377209-18377231 CCACCCTGCCCAACCTCCCACGG No data
1134954822_1134954824 -10 Left 1134954822 16:18377196-18377218 CCACGGGGCAGGACCACCCTGCC No data
Right 1134954824 16:18377209-18377231 CCACCCTGCCCAACCTCCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134954824 Original CRISPR CCACCCTGCCCAACCTCCCA CGG Intergenic
No off target data available for this crispr