ID: 1134955466

View in Genome Browser
Species Human (GRCh38)
Location 16:18380432-18380454
Sequence CACCGACGGAGGCCTGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134955459_1134955466 -8 Left 1134955459 16:18380417-18380439 CCAGGGTGACCACAGCACCGACG No data
Right 1134955466 16:18380432-18380454 CACCGACGGAGGCCTGGGGCTGG No data
1134955456_1134955466 10 Left 1134955456 16:18380399-18380421 CCGCAGGGTTGCTGCTGTCCAGG No data
Right 1134955466 16:18380432-18380454 CACCGACGGAGGCCTGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134955466 Original CRISPR CACCGACGGAGGCCTGGGGC TGG Intergenic
No off target data available for this crispr