ID: 1134957152

View in Genome Browser
Species Human (GRCh38)
Location 16:18387509-18387531
Sequence GCCAGGCACATGCCACCAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134957141_1134957152 11 Left 1134957141 16:18387475-18387497 CCAAAGTCCCAGGTGTAGCGGTA No data
Right 1134957152 16:18387509-18387531 GCCAGGCACATGCCACCAGCCGG No data
1134957145_1134957152 4 Left 1134957145 16:18387482-18387504 CCCAGGTGTAGCGGTAGGGGAAC No data
Right 1134957152 16:18387509-18387531 GCCAGGCACATGCCACCAGCCGG No data
1134957146_1134957152 3 Left 1134957146 16:18387483-18387505 CCAGGTGTAGCGGTAGGGGAACG No data
Right 1134957152 16:18387509-18387531 GCCAGGCACATGCCACCAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134957152 Original CRISPR GCCAGGCACATGCCACCAGC CGG Intergenic
No off target data available for this crispr