ID: 1134961106

View in Genome Browser
Species Human (GRCh38)
Location 16:18405395-18405417
Sequence CTGGAGGCAGAGCTGGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134961100_1134961106 -7 Left 1134961100 16:18405379-18405401 CCTTCCGCCGGCTTTCCTGGAGG No data
Right 1134961106 16:18405395-18405417 CTGGAGGCAGAGCTGGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134961106 Original CRISPR CTGGAGGCAGAGCTGGAGAC AGG Intergenic
No off target data available for this crispr