ID: 1134963951

View in Genome Browser
Species Human (GRCh38)
Location 16:18426629-18426651
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 3, 1: 1, 2: 2, 3: 9, 4: 186}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134963951_1134963960 1 Left 1134963951 16:18426629-18426651 CCTCGCCATCTCTGAGCAGTGGG 0: 3
1: 1
2: 2
3: 9
4: 186
Right 1134963960 16:18426653-18426675 GGAAATGGAAGAACAGGGACTGG 0: 4
1: 1
2: 4
3: 57
4: 678
1134963951_1134963961 7 Left 1134963951 16:18426629-18426651 CCTCGCCATCTCTGAGCAGTGGG 0: 3
1: 1
2: 2
3: 9
4: 186
Right 1134963961 16:18426659-18426681 GGAAGAACAGGGACTGGCCAAGG 0: 4
1: 0
2: 1
3: 33
4: 401
1134963951_1134963958 -5 Left 1134963951 16:18426629-18426651 CCTCGCCATCTCTGAGCAGTGGG 0: 3
1: 1
2: 2
3: 9
4: 186
Right 1134963958 16:18426647-18426669 GTGGGGGGAAATGGAAGAACAGG 0: 4
1: 0
2: 1
3: 53
4: 412
1134963951_1134963959 -4 Left 1134963951 16:18426629-18426651 CCTCGCCATCTCTGAGCAGTGGG 0: 3
1: 1
2: 2
3: 9
4: 186
Right 1134963959 16:18426648-18426670 TGGGGGGAAATGGAAGAACAGGG 0: 4
1: 0
2: 4
3: 65
4: 544
1134963951_1134963962 8 Left 1134963951 16:18426629-18426651 CCTCGCCATCTCTGAGCAGTGGG 0: 3
1: 1
2: 2
3: 9
4: 186
Right 1134963962 16:18426660-18426682 GAAGAACAGGGACTGGCCAAGGG 0: 4
1: 0
2: 0
3: 33
4: 268
1134963951_1134963965 24 Left 1134963951 16:18426629-18426651 CCTCGCCATCTCTGAGCAGTGGG 0: 3
1: 1
2: 2
3: 9
4: 186
Right 1134963965 16:18426676-18426698 CCAAGGGAAACTGTCTGGATTGG 0: 4
1: 0
2: 3
3: 14
4: 187
1134963951_1134963963 19 Left 1134963951 16:18426629-18426651 CCTCGCCATCTCTGAGCAGTGGG 0: 3
1: 1
2: 2
3: 9
4: 186
Right 1134963963 16:18426671-18426693 ACTGGCCAAGGGAAACTGTCTGG 0: 4
1: 0
2: 2
3: 19
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134963951 Original CRISPR CCCACTGCTCAGAGATGGCG AGG (reversed) Exonic
900229930 1:1551575-1551597 CCCACTGGTCAGGGAGGGGGAGG + Intronic
900388191 1:2420093-2420115 ACCAATGACCAGAGATGGCGGGG - Intergenic
902388267 1:16088407-16088429 ACCAAGGCTCAGAGAGGGCGTGG + Intergenic
902403515 1:16171072-16171094 CCCACCACTTAGAGATGCCGAGG - Intergenic
902980421 1:20118702-20118724 CATACTGCTAAGAGATGGCGGGG + Intronic
903213032 1:21829205-21829227 CCCATGGCTCAGAGAGGGCTAGG + Intronic
903668863 1:25023870-25023892 CCCAAGGCTCAGAGATGGGCTGG + Intergenic
904360850 1:29970939-29970961 CCCACTCCAGAGAGAGGGCGAGG - Intergenic
904829847 1:33299628-33299650 CCCTCTGCTCAGTGATGCCCAGG - Exonic
907073530 1:51558792-51558814 CCCACTGCCCAGAAAAGCCGGGG - Intergenic
909108123 1:71438846-71438868 CTCACTGGCCAGTGATGGCGTGG + Intronic
909215301 1:72879029-72879051 CTCACAGCTCTGAGATGGTGTGG + Intergenic
911414031 1:97547873-97547895 CCCACTACTCAAAGATGCCAAGG + Intronic
912450822 1:109766501-109766523 CCCACTGCCCAGGGCTGGTGGGG + Intronic
915102091 1:153507951-153507973 GGGACTGCTCAGAGAGGGCGGGG + Intergenic
915210499 1:154305237-154305259 CCCATTGTTCAGAGCTGGGGTGG + Intergenic
917654440 1:177112378-177112400 CCAGGTGCTCAGAGAAGGCGTGG - Intronic
917703085 1:177600905-177600927 CCCACTGGTCTGACATGGCATGG - Intergenic
920051838 1:203169017-203169039 CGCCTTGCTCAGAGAGGGCGCGG + Exonic
920195553 1:204223841-204223863 CCCTTTGCCCAGAGATGGCCTGG - Intronic
920329000 1:205191354-205191376 CACACTGCTCAGTGATGTGGTGG + Intronic
922419777 1:225451816-225451838 CCCACTTGTCAGAGATGGTTTGG + Intergenic
923015783 1:230125959-230125981 CCCAGTGCTCAGAGGTTGGGTGG + Intronic
923754490 1:236778382-236778404 CCCACTCCTCAGAGATTGCAAGG - Intergenic
1065198744 10:23293322-23293344 CCCACAGCTGACAGATGGTGGGG - Intronic
1067134484 10:43595859-43595881 CCCACAGCTCAGAGTTGTGGTGG - Intergenic
1069639187 10:69944008-69944030 CCCAGTTTTCAGAGTTGGCGAGG - Intronic
1070977551 10:80617258-80617280 TCCACAGCCCAGAGATGGCTGGG - Intronic
1072863518 10:99032288-99032310 CCCACTGCTTAAAGAAGGGGTGG + Intronic
1073878304 10:107950683-107950705 CTCACTGCCCGGAGCTGGCGGGG - Intergenic
1075086922 10:119419837-119419859 CCCACGGCTCAGAGAAGGGAGGG - Intronic
1075598888 10:123752821-123752843 TCCACTGCTCAGAAGTGGCCAGG + Intronic
1076207168 10:128612506-128612528 CCCACAGCTCAGAGTTTGCCTGG - Intergenic
1076239380 10:128892517-128892539 CCCACTGCTCAGAGGTGCATGGG + Intergenic
1077583798 11:3435199-3435221 CTCACTGCCCAGGGACGGCGGGG + Intergenic
1077938516 11:6815293-6815315 GTCACTGCTCATAGATGGCATGG + Intergenic
1078178097 11:8985776-8985798 CCCACTACTTTGAGATGCCGGGG + Exonic
1079060971 11:17248531-17248553 CCCTCTGCTAAGAGAAGGTGTGG - Intronic
1080503087 11:32888423-32888445 CTCACTGCCCAGGGCTGGCGGGG + Intergenic
1083603455 11:63962641-63962663 CCCACTGCTTACACATGGCCTGG - Intergenic
1084044293 11:66560010-66560032 CCCACTGATCGCAGATGGCCTGG - Exonic
1084070353 11:66729291-66729313 CCTACTTCTCAGAGCTGGAGTGG - Intergenic
1084150137 11:67284249-67284271 GCCACCGCTCCGAGATGGTGAGG - Exonic
1084934075 11:72577720-72577742 CCCAACACTCAGAGATGCCGAGG + Intronic
1088693022 11:112344009-112344031 CCCACTGCCCAGAGAGGCTGAGG + Intergenic
1089330891 11:117688311-117688333 CCCACTGCTTGGAGATGGGAGGG - Intronic
1097548023 12:61029123-61029145 CCCACTGCTCTCAGCAGGCGTGG + Intergenic
1103047470 12:117749262-117749284 CCCACTTCTCAGAGCTGGTAAGG - Intronic
1103342593 12:120229026-120229048 CCCACTGCTCCGAGGAGGAGGGG + Intronic
1104824678 12:131700705-131700727 CACAATGCTCAAAGATGGGGAGG - Intergenic
1105614676 13:22001015-22001037 CACACTGCTGTGAGATGGCAGGG + Intergenic
1108718316 13:53104387-53104409 CCCACAGCACATAGATGGAGTGG - Intergenic
1109369252 13:61399951-61399973 CCCACTGCTCAGAAAAGGGCTGG - Intergenic
1119886968 14:78151549-78151571 CCTACTGCTCAGAGCTGCCAGGG - Intergenic
1119982636 14:79099300-79099322 CTCACTGCACAGAGAGGGAGAGG + Intronic
1121928061 14:97947355-97947377 CCAAGTGCTCAGTGATGGGGTGG - Intronic
1122178776 14:99939610-99939632 CCCAGGGCTCAGGGCTGGCGCGG - Intronic
1124193249 15:27598385-27598407 CCCGCTACTCAGAGATGAGGAGG + Intergenic
1124600604 15:31130070-31130092 GCCACTGCTCAGAGCTGCCTGGG + Intronic
1128880874 15:71241745-71241767 CCCACTGCCCTGAGGTGGGGTGG - Intronic
1129333270 15:74838494-74838516 CCCTCATCTCAGAGATGGCCCGG - Exonic
1129379136 15:75154501-75154523 CCCACTGCACAGAGAAGACTGGG - Intergenic
1132456896 16:29078-29100 CCCACTTCTCAGAGAGGTCAGGG + Intergenic
1132902338 16:2264102-2264124 CCCACTCCCCACAGATGGCTCGG - Intronic
1133121407 16:3611134-3611156 CCCACGGCTCACAGCAGGCGAGG + Intronic
1134358317 16:13505571-13505593 CCCACTGCTGAGATGTGGAGTGG + Intergenic
1134515920 16:14886841-14886863 CCCACTGCTCAGAGACGGCGAGG + Exonic
1134703592 16:16285485-16285507 CCCACTGCTCAGAGATGGCGAGG + Exonic
1134963951 16:18426629-18426651 CCCACTGCTCAGAGATGGCGAGG - Exonic
1134968238 16:18509165-18509187 CCCACTGCTCAGAGATGGCGAGG - Intronic
1136922638 16:34345052-34345074 CCCACTGCTGAGAGCTGGGTAGG - Intergenic
1136981935 16:35066754-35066776 CCCACTGCTGAGAGCTGGGTAGG + Intergenic
1137639963 16:50020201-50020223 CCCACTACTCAGGGAGGCCGAGG + Intergenic
1138455662 16:57119294-57119316 CCCACTGCTTAGAGATCCCTGGG - Intronic
1138625782 16:58250207-58250229 CCCAGTGCTCAGTGAGGGCTTGG - Intronic
1139284211 16:65796348-65796370 CCCACTGCAGAGAGAAGGCTGGG - Intergenic
1139633784 16:68245879-68245901 CCCACTCCTGAGGGATGGTGGGG + Intronic
1139690376 16:68637954-68637976 CCCACTGCTTAGGGAGGCCGAGG + Intronic
1141759377 16:86017608-86017630 CCCAATGCTCTGAGAGGCCGAGG - Intergenic
1142150855 16:88511986-88512008 CCCACCACTCAGGGATGGCCGGG - Intronic
1142222163 16:88860845-88860867 CCCTCTGCTCAGAGACGGGCCGG - Intronic
1142991131 17:3731738-3731760 CCCACAGCACAGAGATGACAAGG + Intronic
1146288800 17:31593756-31593778 ACCCCTGCTCCGAGATGGCATGG - Intergenic
1146943652 17:36860121-36860143 CCCGCTCCCCAGAGATGGAGTGG - Intergenic
1147212102 17:38877739-38877761 CCTCCTGCCCAGAGCTGGCGAGG - Intronic
1147467620 17:40622820-40622842 CCCACTGCTCACAGATTGACAGG + Intergenic
1147620741 17:41865125-41865147 CTCACTGCTCAGAGCTGTCCTGG - Exonic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1152584324 17:81182250-81182272 CCCACTGCAGAGAGGTGGCCAGG + Intergenic
1156994351 18:43447954-43447976 CCCACTGCTTAGAGGTAGCAAGG - Intergenic
1157532160 18:48430198-48430220 CGCAGTGCTGAGAGATGGCAGGG - Intergenic
1160539030 18:79610466-79610488 CCCTCTGCTCTCAGATGCCGGGG - Intergenic
1160773986 19:846445-846467 CACACAGCTAAGAGGTGGCGTGG - Intronic
1161816103 19:6501182-6501204 CCCACAGACCAGAGATGGGGTGG - Intronic
1163603584 19:18262478-18262500 CCCACTGTCCATAGATGGCTGGG + Intronic
1164034362 19:21439981-21440003 CCCACAGCTCAGAGTTGTGGTGG - Intronic
1167064789 19:47176806-47176828 CCTTTTGCTCACAGATGGCGAGG - Intronic
1167463070 19:49636435-49636457 CCCTCTGCTCGGTGATGCCGGGG + Intronic
924978097 2:196167-196189 CCCACTGGGAAGAGATGGAGGGG + Intergenic
927485290 2:23484653-23484675 CACACTGTTCTGAGATGGAGAGG - Intronic
927904703 2:26848237-26848259 CCCACTCCTCCGAGATGCTGCGG - Exonic
929567880 2:43000873-43000895 CCCTCTGCTCTGTGATGGGGAGG + Intergenic
932434981 2:71697821-71697843 CCCAGGCCTCACAGATGGCGGGG - Intergenic
933639100 2:84740655-84740677 CCCACGCCTCAGAGCTGGTGGGG + Intronic
934568818 2:95355249-95355271 CCCACTGCCCTGAGCTGGTGTGG + Intronic
935680838 2:105635769-105635791 GCCACTGCTCAGGGATGGCGAGG + Intergenic
937316569 2:120935476-120935498 CCCACAGCCCAGAGATGGGGAGG - Intronic
944158645 2:196636196-196636218 CCCACTGCTGTCAGATGGGGTGG + Intergenic
945046603 2:205787362-205787384 TCCACTGCTCAGGGTTGGCATGG + Intronic
946353410 2:219169941-219169963 CCCACTGATCGGAGTTGGCTGGG + Exonic
946669745 2:222090028-222090050 CCTACTGCTGGGACATGGCGAGG - Intergenic
947461131 2:230305968-230305990 CCCAAGGCTCAGGGATGGCTTGG - Intronic
1170652613 20:18256662-18256684 CCCACTGCTCAGAGATAAGCAGG - Intergenic
1171035365 20:21709147-21709169 CCCCCGTCTCAGTGATGGCGTGG + Intronic
1171427411 20:25057608-25057630 GCCACTGCTTAGAGCGGGCGGGG + Intronic
1178683159 21:34690181-34690203 CTCACAGCTCAGAGAGGGTGAGG + Intronic
1178948526 21:36966994-36967016 CCCACTCCTCAGCCCTGGCGCGG - Intronic
1179994568 21:44967998-44968020 CCCCCTGCTGAGAGCTGGGGTGG + Intronic
1180942414 22:19667958-19667980 CCCACTGCTCAGACCTCGAGGGG - Intergenic
1181823318 22:25493137-25493159 CCAACTGCTCAGAGGCGGAGGGG + Intergenic
1184373419 22:44097107-44097129 CACACAGCTCAGAGATGGCATGG + Intronic
1184524340 22:45012967-45012989 GCCTCTGCTCAGAGATGACCTGG + Intergenic
1184893484 22:47393554-47393576 CCCACTGCACAGAGTGGCCGAGG + Intergenic
1185162200 22:49236791-49236813 CTCAATGGACAGAGATGGCGTGG - Intergenic
949341785 3:3038412-3038434 CGCCCTGCTCAGAGCTGGGGTGG - Intronic
950785828 3:15434670-15434692 CTCACTGTTCAGAGATGGGGAGG + Intronic
951467850 3:23021048-23021070 CCCATTTCTAAGAGAAGGCGGGG + Intergenic
953347273 3:42186608-42186630 CCCTCTGCTCAGAAGTGGCTAGG - Intronic
953719879 3:45346141-45346163 GACACTGTTCAGAGATGGAGAGG - Intergenic
953932080 3:47010438-47010460 CCCGCTGCTCAGAGTAGGCTGGG + Intergenic
962204305 3:133422564-133422586 TCCACTGCTCAGAGATGATGGGG - Intronic
962874868 3:139528173-139528195 CACATTGCTCAGAGAAAGCGTGG - Intronic
967876714 3:194272565-194272587 CCCACCGCTCAGAGGAAGCGAGG + Intergenic
968494486 4:907754-907776 CCCGCTTCTCAGAGATGCCACGG + Intronic
969345680 4:6568379-6568401 CCCACTGCTCCGTGCTGGCTGGG - Intergenic
969846248 4:9922611-9922633 CCCACTGGACAGAAATGGCTGGG - Intronic
980894270 4:138846421-138846443 CCAAATGTTCAGAGATTGCGAGG + Intergenic
985754403 5:1704563-1704585 CCCACTGCGCAGAGCTGACCAGG + Intergenic
985774413 5:1833419-1833441 CCCACAGCTCTGAGAAGGCCAGG - Intergenic
986457612 5:7935054-7935076 CCCACTGATCAGAGAAGCAGGGG - Intergenic
987329608 5:16844821-16844843 ACCACTGCTAAGAAATGGGGTGG + Intronic
988051949 5:26042209-26042231 CCCGCTCCTCAGAGCTGGTGGGG - Intergenic
989132058 5:38116722-38116744 CCCACTGCTGAGAGTTTGCTTGG + Intergenic
989378552 5:40791052-40791074 CTCACTGCACAGTGATGGTGGGG - Intronic
991291159 5:65035085-65035107 CCCGCTGCTGGGAGGTGGCGGGG - Intergenic
991952073 5:71955917-71955939 CCCCCAGCTCTGAGAGGGCGTGG - Intergenic
993902938 5:93596601-93596623 CCCACTGCGGGGAGATGGGGTGG - Intergenic
996716656 5:126593749-126593771 CCCTCTGCTCAGAGATGAAATGG + Intronic
1001963748 5:175895913-175895935 CGAACTGCTCAGACAGGGCGAGG - Intergenic
1003817498 6:9858551-9858573 CACACTGCAAAGAGATGGCAGGG + Intronic
1005692983 6:28325070-28325092 CCCACAGCTCACAAATGGGGAGG + Exonic
1009390750 6:63140471-63140493 CCCACTGCCCTGAAATGGCAAGG + Intergenic
1009838833 6:69040633-69040655 CCCACTACCCAGAGATGCCCAGG + Intronic
1011515152 6:88145518-88145540 CCCAAAGTTCAGGGATGGCGTGG + Intronic
1013507428 6:110814733-110814755 CCGAGTGCTCGGAGACGGCGGGG - Intronic
1014978673 6:127921048-127921070 CCCACTGCACAGAGATGGCCTGG + Intergenic
1015867857 6:137745319-137745341 CCAACTGCTCAGATATGTCATGG + Intergenic
1016385426 6:143526202-143526224 CTCACTCCTCAGAGATTGCTGGG - Intergenic
1016962098 6:149683745-149683767 CCCACTGCTCGGGGATGACTGGG + Exonic
1017220375 6:151959520-151959542 CCCACTGCACAGCGTTGGCACGG - Intronic
1019749787 7:2721765-2721787 CCCACTTCTCAGCAGTGGCGGGG + Intronic
1020220021 7:6229032-6229054 CCCTCTGCTCAGAGGGGGTGTGG - Intronic
1022694655 7:32692480-32692502 CTCACTACACAGAGATGGTGTGG - Intergenic
1022927836 7:35073980-35074002 CTCACTACACAGAGATGGTGTGG - Intergenic
1023042223 7:36181720-36181742 CCCACTGCTCCGTGATGCTGAGG - Intronic
1023854395 7:44173271-44173293 CTCACTGCTCAGCAATGGCAAGG + Intronic
1023867327 7:44244419-44244441 CCCACCGCTGGGAGATGGTGAGG - Intronic
1024558767 7:50626566-50626588 CCAAGGGCTCAGACATGGCGAGG - Intronic
1026036441 7:66833294-66833316 CCCAGAGCTCACAGATGGTGAGG - Intergenic
1026037512 7:66840207-66840229 CCCAGAGCTCACAGATGGTGAGG - Intergenic
1029784401 7:102772936-102772958 CCCAGGGCTCAGAGAAGGTGAGG - Intronic
1030405177 7:109101450-109101472 CCCAGTAATCAGAGATGGAGAGG + Intergenic
1031484466 7:122310798-122310820 CCCAAGGCTGAGAGATGGCGAGG + Intergenic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1033278965 7:139992391-139992413 CCCTCTGCTGGGAGCTGGCGGGG - Intronic
1035394770 7:158527622-158527644 CCCACTGCTCAGCCATGTGGGGG + Intronic
1035628234 8:1089581-1089603 CCCACTGCTCAGAGTTGGGTTGG + Intergenic
1041254377 8:55966908-55966930 CCCACTGCCCAGAGCTTGCAAGG + Intronic
1043310830 8:78857389-78857411 CCCACACCTGAGAGAAGGCGTGG - Intergenic
1044292826 8:90492609-90492631 TCCCATGCTCAGAGATGGGGAGG + Intergenic
1044781173 8:95744828-95744850 CCCACTGGTAAGTGATGGCGTGG - Intergenic
1049546683 8:143235113-143235135 ACCACGGCTCAGAGAGGGCAGGG - Intergenic
1053817540 9:41928430-41928452 CTCACTCCCCAGAGAGGGCGGGG - Intronic
1054107796 9:61072102-61072124 CTCACTCCCCAGAGAGGGCGGGG - Intergenic
1054613061 9:67259023-67259045 CTCACTCCCCAGAGAGGGCGGGG + Intergenic
1056690490 9:88804186-88804208 CCCACCGCTCACATATGGCAGGG - Intergenic
1056905693 9:90645780-90645802 CCCTCTGCTCAGACAGTGCGTGG + Intergenic
1058655716 9:107218737-107218759 CCCATTGCACAGAGCTGGAGTGG + Intergenic
1060101173 9:120842498-120842520 CTCACTGCTCAGAGGCAGCGAGG + Intronic
1061873998 9:133534969-133534991 CCCACTGCTCAGAGTGGGGCTGG + Intronic
1062567055 9:137168094-137168116 CCCACTGCTCAGAGACCCCAGGG - Exonic
1062737219 9:138144120-138144142 CCCTCTTCTCAGAGAGGCCGGGG - Intergenic
1186407101 X:9313728-9313750 CACACTGCTCAGAGAGGTGGTGG + Intergenic
1187388828 X:18872571-18872593 CTCAGTGCTCAGCGATGCCGCGG + Intergenic
1189282308 X:39827539-39827561 GCCACAGCTCAGAGCTGCCGAGG - Intergenic
1190534048 X:51408270-51408292 CCCACTGCTGAGGGATGGGAAGG - Exonic
1190649934 X:52559114-52559136 CACACTGCTTAGAGAGGGCAAGG - Intergenic
1192139848 X:68638240-68638262 CCCAGGGATCAGAGCTGGCGTGG - Intergenic
1195228658 X:102823817-102823839 CTCACTGCTCAGAGCTGTCTTGG - Intergenic
1196192740 X:112811488-112811510 CCCAGGGCTCACAGATGGCCAGG + Intronic
1200399464 X:156010645-156010667 CCCACTTCTCAGAGAGGTCAGGG - Intronic