ID: 1134965408

View in Genome Browser
Species Human (GRCh38)
Location 16:18487998-18488020
Sequence CTGGAGGCAGAGCTGGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134965402_1134965408 -7 Left 1134965402 16:18487982-18488004 CCTTCCGCCGGCTTTCCTGGAGG 0: 5
1: 0
2: 0
3: 14
4: 107
Right 1134965408 16:18487998-18488020 CTGGAGGCAGAGCTGGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134965408 Original CRISPR CTGGAGGCAGAGCTGGAGAC AGG Intronic
No off target data available for this crispr