ID: 1134972747

View in Genome Browser
Species Human (GRCh38)
Location 16:18544887-18544909
Sequence TGAGGGCACTTCTGGCTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134972747_1134972752 6 Left 1134972747 16:18544887-18544909 CCAGCAAGCCAGAAGTGCCCTCA No data
Right 1134972752 16:18544916-18544938 CTTCCGGTCACTAACACCCCAGG No data
1134972747_1134972749 -10 Left 1134972747 16:18544887-18544909 CCAGCAAGCCAGAAGTGCCCTCA No data
Right 1134972749 16:18544900-18544922 AGTGCCCTCACACTTGCTTCCGG No data
1134972747_1134972754 9 Left 1134972747 16:18544887-18544909 CCAGCAAGCCAGAAGTGCCCTCA No data
Right 1134972754 16:18544919-18544941 CCGGTCACTAACACCCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134972747 Original CRISPR TGAGGGCACTTCTGGCTTGC TGG (reversed) Intronic